Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2035
Contig Information
Length 661 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10a04    whok10a15    rwhok10a04    rwhok10a15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit helix-loop-helix DNA-binding domain containing protein [Zea mays]
Score 431
Evalue 7.04606e-41
Total Hit Count 412
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2035
GTGGCGGCGGCAAGAAGGCCAAGCTGATGGCCGACGGCGACGACGGCATGGTCACCAGCTACAGCAACATCGACTCCCAGTTTGGCTCGTCTCTGGACAT
GCCTGGCATGGACGACTACCTGCAGCTGCAGCAGGACTCCGTCGCCTGCAGGGTCCGCGCCAAGCGCGGCTGCGCCACTCACCCGCGGAGCATCGCCGAG
AGGGAAAGAAGAACGAGGATCAGCAAGAGGCTTAGGAGGCTGCAAGACCTCGTGCCCAACATGGACAAGCAAACAAATACTTCTGACATGCTGGATATTG
CTGTTGACTACATCAAAGTGCTGCAGGACCAAATCGAGAAACTGAAACAGGACCAAGGAAACTGCTCTTGCTCAGCCGATCAGAAGTGCTGACGCCGAAA
CCCAGATATGTGAGGTTATGTTTGTACCAATGTGATTAGCAAGCCCAAGTTTTGCTTCGGGAGATTAAGTTGTAAATGCCCTTCGTATCTCAAGTAGTCT
CCATATGCCTATCTTCCCCTTTCGTGGTTGTACTATGGATTACTAGTTTCAATGGCTTAAAGACTAGGAGGTGACAAGTAGAGTGTTGTAATTTGAGTAT
GTAAGGCATTGCCAATCTTTCATTTCAACGCAAGTTGGATCGCTTCTGCTTAAAAAAAAAA
page-top