Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2022
Contig Information
Length 1109 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok6c19    whok15j21    rwhok15j21    rwhok6c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor >gi|187663980|sp|Q0J709|UP12_ORYSJ RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor
Score 1007
Evalue 2.90107e-107
Total Hit Count 200
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2022
CCCACCCCCGGGTTTATTTGATAAGATTTGATCCCAATCCTCGCACGTTTCTTGGCCGAGTGGGGGAGAAGATTCCAGAAATGGCCGTCGCCGTAGCCGC
CGGGACCCTCCGTACCTGTTCCGGCGTATTTCCGGCGGCGTCCGGGAACCATCCACTTGCCGGGTGGCGGCCACTTGCACCGGCAGCGCCCGCTAAGCTG
AGATTATTGTCTCCAGCTTTGAGGGTTCCTAGAGCTGCTTCGCCTGCAGCTGTTGAGAATGGGAGCTCTAGCAACAGTAATACAGTCCCTACACCGAAAG
TTATAATAGATCAAGACTCAGATCCAGATGCAACTATTGTGGAAGTAACCTTGGGTGACCGTCTTGGGGATCTCCTTGATACTATGAGTGCCTTGAGGAA
TTTAGGGCTAAATGTTGTGAAAGCTAGTGTTTGCCTCGATTCTTCTGGCAAACACAATAAGTTCGCTATAACAAAGTCGTCAACTGGTCGCAAAATTGAT
GACCCAGAGTTGTTAGAAGCAGTAAGACTGACAATTATAAACAACATGCTTGAGTATCATCCTGAAGCTAGCAGTCAATTGGCCATGGGTGCAACTTTTG
GGCTAGAGCCCCCTACAGAAGTGGTTGATGTGGACATAGCAACTCACATAGAGATCTATGACGATGGTCCTGAAAGAAGTTTACTTGTTGTGGAATCAGC
TGACCGTCCAGGGTTGTTGGTTGATCTAGTTAAGATCATTGCTGACATCAATATCACTGTCCAATCTGGAGAATTTGACACTGAGGGGCTACTGGCCAAG
GCAAAATTCCATGTCAGTTACCGGGGCAAGCCATTAATCAAGGCTTTGCAACAGGTTCTCGCGAATAGCTTGCGTTATTTCTTGAGGAGGCCGACAACAG
AGGATGCCAGTTTCTAAGCATATGATTACAAACCCACGCCTTATCATAGCTCATGAGACATGATATTTGTATGAAGTTAGCACTGTCATCCAAATTATTC
TTGAAATATGCATAATTCCCCAAAAAGGGAGGTACACGATATATCATGTACTCATAGTTTCATGTGAAGGTAGCTTCATGTTGTATGAATTGCATTAGCC
TTCCCAAGT
page-top