Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1996
Contig Information
Length 689 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10a10    whok8d06    rwhok10a10    rwhok8d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L27a-3 [Zea mays] >gi|195621814|gb|ACG32737.1| 60S ribosomal protein L27a-3 [Zea mays]
Score 599
Evalue 2.59106e-60
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1996
GCCTCCACCCCACCCGCCCCGACCCCTCTCCTCCAAGGTAAGCCCGCGGCGGCGGCGAGCGAGCGGCGGCGATGACGACCCGCTTCAAGAAGAACCGGAA
GAAGCGCGGCCACGTGTCCGCCGGGCACGGGCGTGTGGGCAAGCACCGCAAGCATCCCGGAGGCCGCGGTAACGCCGGAGGCATGCACCACCACCGCATC
CTCTTCGACAAGTACCATCCCGGCTACTTCGGCAAGGTCGGTATGCGCTACTTCCACAAGCTCAGCAACAGGTTCTACACCCCGACGGTCAACGTCGAGA
GGCTCTGGTCCATGGTGCCGTCCGAGAAGGCGGCCGAGGCCGGCGGCGACAAGGCCCCCGTGGTCGACGTCTCGCAGTTCGGCTACTTCAAGGTGCTCGG
CAAGGGGATGCTGCCGGAGAAGCCCATCGTCGTCAAGGCCAAGCTCATCTCCAAGATCGCAGAGAAGAAGATCAAGGCCGCCGGCGGCGCTGTCGTGCTC
GTTGCCTAGGGTTCTGTTCGCGACCGTGCCTTGAGATCTATTATATCTGAACTATTAGTTGTTTCCCGTACCAGCAATTTGTGTTGAACAAGACATCGTT
AGTTTGTTATCCTGGTTCCTGTGTGGTAAACCAACATCTTATGAGAATTTTGCGCTATGTTATGCCAGTTTATATCANACGAGTTATCC
page-top