Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1973
Contig Information
Length 664 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10d01    whok3p13    rwhok10d01    rwhok3p13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Acyl carrier protein 3, chloroplastic; AltName: Full=Acyl carrier protein III; Short=ACP III; Flags: Precursor >gi|166971|gb|AAA32922.1| acyl carrier protein III
Score 640
Evalue 4.14824e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1973
ACCCAGTCCATCCCCCGTCGCCCTCACGCTCTTCGTGCTCGCCGCCTCCCTTCGCGTGCTGCCTCATGGCTTCCATCGCCGGATCTGCCGTGTCCTTCGC
CAAGCCCGTCAAGGCAATCAACACGAACTCGCTCTCTTTCTCTGGTCCAAGGAGGGGCAATGCATTTCTTCGCCTGCAGCCAGTGCCGATGAGATTTGCT
GTTTGCTGCTCAGCAAAGCAGGATACAGTGGAGAAGGTTTGTGAAATTGTTAAGAAGCAGCTTGCTGTTCCTGAAGGCACTGAAGTTTGCGGTACCACCA
AGTTCTCTGACCTTGGAGCTGATTCACTGGACACGGTCGAGATTGTGATGGGCCTCGAGGAGGAGTTCCAGATCAGTGTGGAGGAGACGAGTGCGCAGGC
AATTGCGACAGTTGAAGATGCTGCCACGCTCATCGACAAGCTTGTCTCTGCGAAGTCATCTTGAAGGGAGGTCGTAAATCGTAATGATTGGAGCTCGTAA
GCTAGTAGTCCTACCTTGGGTTGATCCTTGTTGTTCTACCATAGTCGTTATTATATGGTGGGTTGGTGATTTTCTCAGGACTATCGTCTCCTGCTGTGTG
TAATAAGATAATTGGTTAAGTATGTAAGCTGTTGAACATCGAAGTGCCCTAGTTTTCGTGCGGC
page-top