Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1923
Contig Information
Length 831 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10e08    whok1b23    rwhok10e08    rwhok1b23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|7248415|dbj|BAA92738.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|24413953|dbj|BAC22205.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|113594653|dbj|BAF18527.1| Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|125553806|gb|EAY99411.1| hypothetical protein OsI_21382 [Oryza sativa Indica Group] >gi|125595832|gb|EAZ35612.1| hypothetical protein OsJ_019095 [Oryza sativa (japonica cultivar-group)] >gi|149391053|gb|ABR25544.1| 60S ribosomal protein l13-2 [Oryza sativa (indica cultivar-group)] >gi|215678596|dbj|BAG92251.1| unnamed protein product [Oryza sativa Japonica Group]
Score 793
Evalue 1.17888e-82
Total Hit Count 341
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1923
GCAAACCCTAGCCCTTCCCCGCCGCCGCCGCCGCCGCACCGTCGTCTCCAGGTAAGGAGGGCGAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCA
CTTCAAGAAGCACTGGCAGAACTATGTCAAGACGTGGTTCAACCAGCCCGCCCGCAAGCAGAGGCGCCGCATCGCTCGCCAGAAGAAGGCTGTGAAGATC
TTCCCTCGCCCCACCTCTGGACCTCTTCGCCCCATTGTGCAATGCCAGACCCGCAAGTACAACATGAAGGCCAGGGCTGGCAGAGGCTTTACCCTTGAGG
AGCTTAAGTCCGCTGGCATCCCAAAGAAGCTCGCTCCTACCATTGGCATTTCTGTGGACCATCGCCGCAAGAACAGGTCGCTGGAGGGTATGCAGTCCAA
TATCCAGAGGCTTAAGACCTACAAGGCCAAGCTTGTTATCTTCCCAAGGCGTGCTCGCAAGGTCAAGGCTGGTGACTCTACTCCGGAGGAGCTTGCCAAC
GCCACACAGGTCCAGGGCGACTACATGCCCATTGCCCGCGGCGAGAAGCGCTCAGTTGAGGTCGTGAAGGTCACAGAGGAGATGAAGGAGTTCAAGGCCT
ATGGCAAGCTCCGCGTCGAGAGGATGAACCAGCGCCAGTTGGGAGCCAGGCAGAAGAAGGCTGCCGAGGCGGAGAAGGAGGAGAAGAAGTGATGAGATGC
TTAAGGCAGCTAGTGGGTTCTGTTGTTATCAAGTGCTAGTTTCTGAATTTCTGTTTTGGCCTTCTCGGACATCTTGTTTGATACCTGATATACTTATTTG
CATGATCTGCTATCAAATCTTATCCTATGAG
page-top