Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1887
Contig Information
Length 1169 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10f21    whok12k19    rwhok10f21    rwhok12k19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_001714 [Oryza sativa (japonica cultivar-group)]
Score 1594
Evalue 2.679e-175
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1887
TGCTATTATTCGAGAAGATGAAATCCGACCAGGGACTTGCATTTACGGTATTCACTGAAGCACAAGTAGAAGAAGCAACAAACAAGTTTGACAAAAGCCA
AATTCTAGGACATGGGGGCCATGGGACTGTTTACAAGGGCATTATTAAGGGTACAAATCCAGTGGCAATCAAAAGATGTGCATTGATTGATGAAAGGCAT
AAGAAGGAATTTGGTAAAGAAATGCTGATTCTCTCCCAGATCAATCACAAGAACATCGTCAAGCTGTTGGGCTGCTGCCTGGAGGTGGAAGTCCCAATGC
TGGTGTATGAGTTCATCCCAAAAGGAACATTGTTTGATCTTCTTCACGGAAAGAACCGCACACGGCACATCCCATTCAGTTCGCTCTTAAGGATCGTAAA
TGAGGCAGCAGAGGGGCTTGCATTTTTACATTCCTATGCAAACCCACCAATTCTACATGGTGATGTGAAAACTTCTAACATCCTTCTTGATGACAATTAC
ATGGCAAAGGTATCCGACTTTGGGGCTTCCATACTAGTACCAACTGATCAAGCCCAGTTTGTGACAATGGTTCAAGGGACTTGTGGTTATCTGGATCCTG
AATATATGCAGACATGTCGGTTGACAGATAAAAGCGATGTTTATAGCTTTGGTGTCGTCCTTTTGGAAGTCCTTACTGGGCAGGTGCCACTAAAACTGGA
AGGTAATGAGTCACAAAGAAGCTTGGCATCATGTTTCCTAGTGGCTATGAAGGAGAACAACCTTGATGCCATGTTGGATAGTCAAATAAAAGATCACGAG
AGCATGGAGCTGCTTACTGGACTAGCGGAACTAGCAAAGCAATGCTTGGATATGTGTGGTGACAACAGGCCCTCCATGAAAGAGGTATCTATGGAGCTTA
CCAGATTAAGGAGGCTTTCCAAACATCCTTGGATGCATCACGATGCTGATACAGAGAGCTTTCTCAGTGCACCATCAACCAGTAGTTTTGAAATAGAACA
AGGCTCTGAATACACAAGGAAGGATGAACAAATGCCCATGAATCCAAGCAGTTCTTACTTTATCAGATGAAGAGAAGTATTGGCAGTTCTATACTGCAGC
ATTTTCATTGGTCCTTCTCCTTCATGTAATCCCTTCTTAAATTAGCTGGCGAAAAAATACTTCCAGATT
page-top