Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1884
Contig Information
Length 375 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10f18    rwhok10f18    rwhok11e05    rwhok11e18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0360600 [Oryza sativa (japonica cultivar-group)] >gi|14587322|dbj|BAB61227.1| putative Dephospho-CoA kinase (27.4 kD) (3K840) [Oryza sativa Japonica Group] >gi|113532552|dbj|BAF04935.1| Os01g0360600 [Oryza sativa (japonica cultivar-group)] >gi|215697395|dbj|BAG91389.1| unnamed protein product [Oryza sativa Japonica Group]
Score 252
Evalue 1.82227e-20
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1884
TTTTTTTTTTACACAAGCAAGCAGTTGCAAATTTTATTTCACTCGAAATTCAGCACTTGGTGGTATAATAACTCCAGACATGACAGGACAGTAATCGTGC
TCGCCTAGTGCTCTGCACTGACCCTTCGAAATTTTCAACCAATCAATCTTAGTCCAATCCTAGTTACCTTAACTTCCTAAGCGTGAAAAGATCACAGCAG
ATTCTTCTGAGCAAGTAGAACCCCCGCCGCCGTGCACACGACGATAGAGAGAAGGCCATCCCTGGACATCATGCGCTCCTTCCATGTCAAGGGACCAGAC
ACCTGCTTCAGCACTTCCTGGAACTGCTCTTTCGTGTCGTCCAGCGAGCCGGAGTTGTCGATCACTATGTCGGCT
page-top