Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1824
Contig Information
Length 710 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10c10    whok15j22    rwhok10c10    rwhok15j22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605228|gb|ACG24444.1| histone H2B.2 [Zea mays] >gi|195605966|gb|ACG24813.1| histone H2B.2 [Zea mays] >gi|195608636|gb|ACG26148.1| histone H2B.2 [Zea mays] >gi|195623720|gb|ACG33690.1| histone H2B.2 [Zea mays] >gi|195644270|gb|ACG41603.1| histone H2B.2 [Zea mays]
Score 511
Evalue 4.37707e-50
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1824
CCTCGCAACAACTCGCCCATTTCCCTCCACAGCAGCCCGACACCTCAAGCTCAATCCCGATCGATGGCGCCCAAGGCCGAGAAGAAGCCCGCGGAGAAGA
AGCCGGCCGCCGAGGTCGCGGAGAAGGCCGAGAAGACCCTCGCCGGCAAGAAGCCCAAGGCGGAGAAGCGTCTGCCGGCGTCCAAGTCCGCCAAGGAGGG
CGGCGACAAGAAGGGCCGGAAGAAGAACAAGAAGAGCGTGGAGACCTACAAAATCTACATCTTCAAGGTGCTCAAGCAGGTGCACCCGGACATCGGCATC
TCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGCGAGGCGGCCAAGCTGGCCAGGTACAACAAGAAGCCCA
CCATCACGTCCAGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAGTT
CACCAGCAACTAGGGTTCCGTCGCGGTGTATCTCTAGGGTTCCGTCGCCGTGTTCTCTTCTACTAGCTTTTGTGTTGCCGTCGCTTGTGTCCATGTGTGT
CGTTATAGGTAGGTAGCTCGTCTGCTTTGTAAATCGTGCCAGGTTGTAATGGACGGCTTTGATTTCAAGTACTAATGGAGGAGTTTGTATGTGCCTTTTC
AAAAAAAAAA
page-top