Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1815
Contig Information
Length 1920 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10g04    whok8i05    rwhok10g04    rwhok8i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0339600 [Oryza sativa (japonica cultivar-group)] >gi|78708252|gb|ABB47227.1| large secreted protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113638990|dbj|BAF26295.1| Os10g0339600 [Oryza sativa (japonica cultivar-group)]
Score 1426
Evalue 0
Total Hit Count 292
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1815
ACGAATGTATCAAGTCACATTTTAGTATCAAATCACAATTTTGGGATGAAGGGAGTATTATTGTTCTCACTGAGAATTCAGTAAATTTTGTCACAACAGG
TTCTGCCTTAGGATAGCTCTATAATTGTTCTCACTGAGAATTCAATAAATTTTGTCGCAACAGATTGTGCCTTCGGACTGCAGAACCAGCACACGCACAT
TCTCACAGTTGCCAAGTCTCCAAGCACTTCAACTCCGAGTTGAACCTGTAAACTTGACCCGGAGAGGCGCTGATCACGGCAGCATGGTCGCCATAGTGGA
TCCTCTCAAGCGCAGGCGAATTCCCGCTGCTGCCAGACCATACAAGAGCTTCATGCAGGCTACCTTCTTTCCAGCAAATGTTAACCGTCAACCCGCCTCG
GGCCCTCAAACCTTTAACGCTGCCATGGGGCCACTTGTCGCGGGGCAGAGCAGGGAGCAGGTACAGATCACTCCCGGTGCTCTGCACAAGCATTTCGCAC
AATGCAGCTGGGAATCCAAAATTTGCATCAATCTGGAATGGTGGATGCGCTGTGAACAAATTGCTGTATAGACCTCCTTCCTTTTCATGCTCGTGCTTTG
GGTCTATCAAAGTGATTAGCTGCAGAATCATTTTGTATGCATGCTTACTGTTGTGAAGATGAGCCCACAGGGCCATCTTCCATGAAGTAGACCACCCAGG
GCCTTTATCACCTCTTTTATAAAGAGTATTGGCTACAGCTTTGCAGAGGTCAGGTGTTTGCTCAAGTGTCATGGTATGTCCAGGATAAAGACCAAACAGA
TGAGATACATGCCTGTGCTGAGGTTCGGGATCCTTAAAATCTTGTGCCCATTCCATGATTGTACCATCTCTACCAATTTTTATTGGCGGGAGCCTTGGTA
GTGCCGCTTTTATCCTCTGAACCACATCAGTGCTGGATTTTCCTAAAATATCAGCAGACAGAAAGAACAGCTGAGAATACTTCTCTAATAATTGACATGT
CCATAGTTGTTGAATAGCTCACAGATGCTTTCTTGCCATCCGGAGCAATAAAATAATGCTCTGGGGAAGTAGAAGGATTGGTCTCCAGATAGCCATCTTG
GCCTTCAATCAACCAGGACAACAGAAAGGAGGCAGATCCTTCCAAAAGTGGATACGCTGTTCTCTCCAAAAATTCTCTGTCCATTGTAAAACTGTAGTGT
TCCCACAGGTGTGTAGCAAGCCATGGCCCACCCATTGGCCATAGAGCCCATGAAGGATCACCAGCATCCGGTGATGTTTTTGCCCACAAGTCTGTGACTT
GGTGACTGACCCAGCCATTAGCTCCGTAATTCACTTTTGCCGTCTTAGCCCCATTGACCGAAAGGGATCCAATGAAGTCGAATAGTGGGTCTTGGCATTC
ACTAAGGTTGCAAGGAAGTGATGGCCAGTAATTCATTTGAAGATTTATATTTGGATGGGGAGCTGTACCCCATGGTGCATTAGTCTCGTTGTTCCATATT
CCTTGCAGATTGGAAACCTGAGTTCCAGGCCTCGAACAAGAAATGAGTAGATAGCGCCCAAACTGAAACAGAAGTTCTACCAGAGAAGGATCTTCATCAT
GTCTAAAACTTATAATTCGGTCTACAGTAGGCTTCTCTGAATTATTAAGCTCGTTTAACCTTGAACAGTCAACCATCGGTACAGTGCAATCAGATACCTC
AGCATCCTGAGAGATATTCTCAGGTAAGTGAGCCAAAGTGCTACCTCCAAGTACACCATTAGAGCCTCGTGAAAGTTGCAAGGACACGCGCTGGAAAAGA
CTTTGGTAATCATCCATGTGATAAGCTTTTAGCTGTGCATATGACATGCTCCTAGCCATATTTAATGTTGTGAATGCTGATGTCACTGGATCAAGTGTAG
ATTCAGAAGGCTGACAAATG
page-top