Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1794
Contig Information
Length 654 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10e22    whok14j11    rwhok10e22    rwhok14j11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative membrane protein [Triticum aestivum]
Score 757
Evalue 1.08696e-78
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1794
CATCGCAGCACACCAGCTTAGACATGGCCGCCGCCACCTCCACCGTCTCCGGCCTCGCCGGCGCCGCGCTCACCCGCCGGCCAGCCTTCTCTACCAGCTT
CACGAGTGGTGCCCGGGTGTCGGCGAGGAACCCGCTGATGACGAGGAACCTGGAGAGGAACGGCAGGATCACCTGCATGACGTTCCCGCGGGACTGGCTG
CGGAGGGACCTGAACGTGATCGGGTTCGGGCTGATTGGGTGGCTGGCACCGTCGAGCATCCCGCTGATCAACGGCAACAGCTTGACGGGGCTCTTCTTCT
CCAGCATCGGCGAGGAGCTCGCCCACTTCCCGTCGCCCCCGGCTCTCCAGTCGCAGTTCTGGCTGTGGTTGGTGACGTGGCACCTGGGTCTGTTCATCGC
GCTCACCTTCGGCCAGATCGGGTTCAAGGGCAGGACCGAGGACTACTTCCAGAAGTAGCGAATTAACTAGCTTTGGTTCGTGCATGTGCGTCGTCCTTGG
GCTGCTCAAGGGCTGCTTCTGCGCATGCGTGTTCAATGTAAAATCTGCCATGCCTTTTGGTTTTGTGCATGCGTGTGGCTTCGCAAGCCGTGTGATTGCT
GTTTGTTAATTACCTCTTCCATGGTAAGCACAAAAGAGTTCAACAAAAAAAAAA
page-top