Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1754
Contig Information
Length 792 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10c09    whok10f06    rwhok10c09    rwhok10f06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit IQ calmodulin-binding motif family protein [Zea mays]
Score 733
Evalue 9.83678e-76
Total Hit Count 35
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1754
ATTAAGCACCAAACTCTTCTACTGGTAGTTCAACAACAGCATACATTACAACAAGTCCAAACAAACAATACGGTTCATACACGCTACGACATCCCGGATA
ATGGTGCACGACAAGTTCAACCCTTCTCAAATCTCAAAGGTACTAGAAATCTAAGACGAACCGGACTATCTCACAGACAAAGCGGCGCTACAAGCTCCAT
CGATCGGCCATGGTACCGGGCACTAAACGAGGCGCTAGTGCCTACTGCTTGCCCTTGCCAGTGTTGATGACTCTGACAGCGTTGTTCACGCCAGCGGTTT
TCTCATTTGGGATCGCTCCGCCCTCTGGAAGATCGAACTTGCGGCGGTTGAACGACCTCTGCTTCCCTGGTGGCTGCGGGTCCACGATCTCCAGCATGCT
CTCCAGTTCCTCCAGCATAGATTTCTTCGCCGTCCTCACCATGAAGTCAGGTCCCTCGAGCGCGTCGACAGTGAGGAGCAGGACAATGATCTTCTCGGAG
AACCTCTGGCGCTCCTCGTGGTCATGCGAGAGGCGGCGCCTGTAGGAGAGGTTGTAGAAGAGGGACCTGAGCTCCTTGAGCTTGGCCTTGGCCACGGCGA
GATCGCGCAGGCAGCGGAGCACCTGGGAGCGGTGGGCGAGGTGCGCCCTGTAGTTCATCTGGATGAGCAGCGCGGCGTCCTGCGGCGACAGCTCCTTGGC
CTTCCCCTTGCCGTTCCCCATGGCAAAAGCCTTGCGGATGGCGTCGCATCCGGCGGTGTTGTCCTCGGGGATCTCCTCGATCTGGACGCACG
page-top