Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1747
Contig Information
Length 708 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10b08    whok18e22    rwhok10b08    rwhok18e22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194699868|gb|ACF84018.1| unknown [Zea mays] >gi|194706942|gb|ACF87555.1| unknown [Zea mays] >gi|195615212|gb|ACG29436.1| DNA-directed RNA polymerase II subunit J [Zea mays] >gi|195628620|gb|ACG36140.1| DNA-directed RNA polymerase II subunit J [Zea mays] >gi|195656859|gb|ACG47897.1| DNA-directed RNA polymerase II subunit J [Zea mays]
Score 577
Evalue 9.7285e-58
Total Hit Count 313
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1747
CCCGCTAGTACTACTCTCTAACCTTACCCAGACCGCCGCAGGTCTTCATCGTCTTCCTCGGAACGCCGCCGCCGAAGTGCGCCTCGAGTAATTTCAGAGG
AAGGAGGAGCCAAGTGTTGATCGGAGATGAATGCCCCTGACCGCTATGAGCGCTTCGTCGTGCCTGAGGGCACGAAGAAGGTATCATTTGAGAAGGATAC
AAAGATCATGAATGCTGCATCTTTCACTATTGAACGTGAGGACCACACCATCGGGAACATCCTCCGCATGCAGCTGCACAGGGACCCAAATGTTCACTTT
GCTGGCTATAAGCTCCCTCACCCCCTTCAGTACAAGATCATTGTTAGGATCCATACTGCAAGCCAATCCTCCCCAACTCAGGCATATACCCAGGCAATCA
ATGATCTAGACAAGGAGCTTGAGAACCTGAAGCAAGCTTTTGAGGATGAGAAGACCCGATTCGAGGAAAGGATGAAGCAGGGCTACTAGGCCAAGGGTGT
TCTGGATGCTGACGTGAAACCTTCCTTGCTAGTAATTATATCTGATGTCTGAACTGCGGTAGAAAAAAAATTACTCAAGGATTGTCGATGATCCTCTGAA
CTCGTAGAACCTCTTCATGTGCGGATTGCGTATGATTGCACGGTTGTTAAACATGTGTTGGCACTTGATAAGCCTGCTAGTTGAATTGCTCGCCTTTGAA
AAAAAAAA
page-top