Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1740
Contig Information
Length 1309 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10a18    whok5f19    rwhok10a18    rwhok5f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cysteine synthase; AltName: Full=O-acetylserine sulfhydrylase; AltName: Full=CSase A; AltName: Full=O-acetylserine (Thiol)-lyase; Short=OAS-TL A >gi|218335|dbj|BAA02438.1| O-acetylserine (thiol) lyase [Triticum aestivum]
Score 1504
Evalue 8.57679e-165
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1740
TATGGACCACAGAGGAGGAGTTCAATATACAGGGCAGGCAGGAGGTAATTCAAATTGCTAAACACCACAAGGCCAACACAAAAGTATTCCCCATTGCCAC
ACAAGGTGGGATTAAAACTTGACAGGACTTTGATGTCAGACCAACACTAGCAGGGACGCCGAAGATTTATTTCTTGTAGAAGAGGGCTCCTATGAATGGA
GGGATTCGGCTTCGGAGAACAGCTTCGCGCGCTTGAGGAGACGAGTCCCGAGCGTCACTCGACCACCATGCTCTCGGCCTCCTTCTTGATGGAGTGGAAG
AGCACCGACGAAAGGTAGCGCTCTCCGAAGCTCGGGAACACAACAACAAAGAGTTTCCCTGCATTTTCAGGCCTCTGAGCAACCTTGATTGCAGCAGCTG
CAGCAGCACCAGAAGAGATCCCAACCAGCAATCCTTCTTTCAATGCAAGAGACTTTGCCATCTCAATAGACTCATCACTTGAAACCTGTATGGTTTCATC
AATGATGTCAACATCCAAGACACCAGGGATAAAACCAGCTCCAATTCCTTGGATCTTGTGTGGTCCAGGCTTTCCACCATTTAAGACAGCACTCTCGGTA
GGCTCCACACCGTAGAGCTTGATGTTAGAGTTTTGCTCTTTGAGGTACTTTCCAGTTCCAGTAATGGTACCACCTGTCCCGATGCCAGAAACAAGGCCAT
CGATCTTTCCACCTGTGCCTTTCCAGATTTCAGGCCCAGTTGTCTCGTAGTGAATCTTTGGGTTGGCAGGATTCTCGAACTGCTGAAGGATGTATGAGTT
GGGCGTCTTTGCTGCAAGCTCTTCCGCCTTTTGGACAGCTCCTTTCATTCCCAAGAGTGGGTCGGTGAGGATCAGCTCAGCACCAAAGGCCTTCAAGATG
ATTCTCCTCTCCATACTCATGGAGGCGGGCATTGTGAGTACAAGTCTGTAACCCTTGGCAGCAGCCATGAAGGCCAGCCCAATGCCTGTGTTGCCACTGG
TTGGTTCAATCAGCACACTCTTGCCTGGGACGATGAACCCCTTCTCCTCCGCGTCGGTGATCATGCTGTACCCAATCCTGTCCTTGACGCTGGAGCAGGG
CTCCATGGACTCGAGCTTGGCGGCGACGCGCCCCACGCACCCGTCGGTCACCTTGTTGAGGTACACCAACGGCGTGTTCCCGATCAGCTCGGTGACATCC
TTGGCGATCGCCGGAGTGGACGCCTCCCCCATCCCGCCGTCGACGAGCGATTTGGCAGCGAAGCGATCCTCCCGGGGCCGGAGCTGGACGAAGTGGCGGC
TGTCGCTGG
page-top