Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1726
Contig Information
Length 1065 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10b19    whok2f04    rwhok10b19    rwhok2f04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0299000 [Oryza sativa (japonica cultivar-group)] >gi|50508226|dbj|BAD31730.1| unknown protein [Oryza sativa Japonica Group] >gi|113623453|dbj|BAF23398.1| Os08g0299000 [Oryza sativa (japonica cultivar-group)] >gi|215678729|dbj|BAG95166.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692469|dbj|BAG87889.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708833|dbj|BAG94102.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1411
Evalue 3.86529e-154
Total Hit Count 384
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1726
GAATCCCCTTCCTTCCTTCCTTCCGTCCCCGACGACGATGGAGCGCGTGAGAAGGGCGTCGCATGCCGGCTCCTGGTACACCAACAACGCCAGCAAGCTG
GAGGAGGAACTTGATGGTTGGCTTTCGGCAGCTGCTCTCACCAAGTCACCTGATGTTAGGGCCGTAATTGCACCCCATGCTGGCTATTCGTACTCAGGGC
GATGTGCAGCTTATGCTTTTGGCAACATTGATCCAACTAACATTTCTCGGGTGTTTCTGCTCGGCCCATCTCATCACTACTATACTCCAAAATGTGCTCT
GTCAAGAGCTACTGTTTATAGCACCCCGATTGGGGATTTACCAGTAGACCTGGAAGTTATCGAGGAACTCAAAGCTACCGGAAAATTTGAATTTATGGAC
CTTAATGTCGATGAGGCTGAACATAGCATGGAAATGCATTTGCCTTACCTTTCTAAAGTATTTCAGGGACATAATGTAAAAGTTGTACCTATCCTTGTTG
GTGCTGTCAACTCCCAAAATGAAGCCATGTATGGGCAGTTGCTTGCAAAATATGTGGATGATCCAAAGAACTTTTTTTCTGTCTCCTCAGACTTTTGCCA
CTGGGGATCTCGGTTTAGTTATACATACTATGACAAGAAGCATGGTGCCATTCACAAATCAATCGAGGCGTTGGACCGCTTGGGCATGGAGATCATAGAG
ACTGGTGACCCCGACGCGTTCAAACAGTATCTCGAGGAGTACGAGAACACCATATGTGGACGCCATCCCATCAGCGTCCTTCTTCATATGTTGAAACACT
GCTCGACGAAGATTAAGGTCGGGTTTGTTCGCTATGAGCAGTCGAGCCAGTGCAAGAGCACGAGGGACAGCAGTGTCAGCTACGCATCTGCTGCGGCCAA
GGTGGACAGTCCTGGAGAAGAAGGTAAAGATTGAGCAAAACGTGGTTTGCTGGGTACACCCTGGTGTAACGTGCTGTAGCATGGCTGTTGGCTTGCAATC
ACCGGAGCTTTCTGTCGAACTTTGTAATAATAGCAGGCTCTGGTTGAAGTCCCATAGTAGCTGCT
page-top