Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1592
Contig Information
Length 915 bp
Tissue Seed DPA5
Clones 3 Clones [Download: CSV  ,  FASTA ]
whok10d20    rwhok10d20    rwhok3j17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09285 [Oryza sativa Indica Group]
Score 812
Evalue 8.73665e-85
Total Hit Count 67
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1592
TTTTTTTTTTCAACAAACGACTGGTTATTACGCTAACCCAAATGGCCAGGGTACTGTATTGATTAACATCATCGCCATATGTACAACACTACAACAGTGA
GTCGTGATATATACGTACTACTGTGTCACGAGGCTAAATATTTATGTACACCAAGGGGCCTGCCTGCTTGTCGTCGTGGGAGAAGGCGCCGGCTTACCCA
GGCCGGAGTAGCTATTTCCACACCTTGACTGCGCCGTCTCTGCTGGCCGATATCAACCGCTGGCTCGACAAGTTGACGGAGGCCAACGCGAGGATCGCGT
CCCGGTGGCAGCCGGCAGAATCGGCGGCGGCCATCGCGAGCTGCGTCTTGTGCGTCAATCTGGACGCCGGTGTAGGCGGTTTGCACGATTCCTGCACAAC
CTGTACACCATAGCTGGATCGTATGTCGTAAAACTCGTCGTTTCCAACTCCTTTTGCTGAAGGACCAGCGATGCAGAAGCTTTGCTCAGGTCTGGCCTGG
TCCCAGTAACGTATCTTTAAATCTGTTCCGCCGGTCAACAGATCTCCCCCTGGCAAAGGAAGCAGGCACCGGATGCCTGGAAGGCGTGGAGGCGGATCGG
CCAGTTCCTCAATTCTGTACTTGTAGTTTCCTGCTCGCCTCACGTCTTTGGCGGTTGTCTTGTTAAGAGGTTTTGATGGTGTCTTTGGCGTAACAGCATC
ATTCTCGGTGCCTGCTGTCCTAAACATCTGGTGGCAGCTACCATTCTCGGCATTCCACAAGGAGACTTCATTGCANCCCGCANCCACAAAAACNAGTGGT
CTTCCACTANAANATATTGANTTGTGTGGTGGTATAANCAANCACAATTTCTCTATANGGCTTACTGTGGAATANTTCCACNANTTGACANGCANCANAA
ACCTATGATCCCACA
page-top