Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1512
Contig Information
Length 575 bp
Tissue Seed DPA5
Clones 3 Clones [Download: CSV  ,  FASTA ]
whok10e20    rwhok10e20    rwhok20n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 4F5 protein family protein [Zea mays]
Score 108
Evalue 0.00146139
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1512
TTTTTTTTTTAACTTAAGAGAGAACGCTGCTGCTTATTATCATTATTATCATCACGAGTTGAGGATTTCATCAGAGTACAACAAACTCATGCAACAAAGA
TTTGCAGCCAACGACAGTTTTAACCAACCATACACGATTAAGGCACAAGGATCCGCAGATGCTGCGAGCAAACAGGGTACAGACGCATGGCAATCGTGGT
GGCGCCGGCGTCCCATCCCGGTGGCGGGGGCGGGATCCGGCGGCGCCTCTCCTGCTACTTCTTGGCGTCCTTGCCCTTGGCGTCCGTGGAGGTGCTCCCG
GAGGCCTGCGCCGCCTTCTTGGCGTTCTTCTCCTCCAGCGCCTTCTTGTCCCTCTCGCGGCGCTGCTCCGGGGTGAGGCCGTCGCCGCCGTTCTTGGAGT
TGGGCTTCCGCGCCGCGGCGCGCTCGCGGTCGCGCTCCCTCTGGCTGCCCCGAGTCATCTTCTTGCTTGATTCCCTTCCGCCGGCGGCGACTCTCTTCTT
GTTGGGGGTTCTTTCTCTCCTCTGTCTCCCCGTTCCCCTTANNTCCNNCGCGATTTTGTGAATCTTGGGGTNGTT
page-top