Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1505
Contig Information
Length 969 bp
Tissue Seed DPA5
Clones 3 Clones [Download: CSV  ,  FASTA ]
whok10c22    rwhok10c22    rwhok11m02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small basic membrane intrinsic protein1b [Zea mays] >gi|75308067|sp|Q9ATM2|SIP12_MAIZE RecName: Full=Aquaporin SIP1-2; AltName: Full=Small basic intrinsic protein 1-2; AltName: Full=ZmSIP1-2; AltName: Full=ZmSIP1;2 >gi|13447815|gb|AAK26765.1| small basic membrane integral protein ZmSIP1-2 [Zea mays]
Score 816
Evalue 3.30489e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1505
CTTTTAGTTAACATCGATGTAATGTTGAGGGGATTAAATACAGGCCTTCCAAATTATTCCCTAGCAAACCATGTTCCCTTCTTCAGGTCCCCCAATTGCT
AAGTCAAAGTTTGTGCTTGAGTTCATCATGCTTTCTTGGTCTTGGGCTTAGGGGCCGGTGGCGGGAACACGGCCCTGAAGGTTCCACGCAGCGAGAATGG
CACCGATGAAGGGGCATATCCAGTACACGTACAGCTGCTCCCAGGTGTTGTGCAGATTGTTAACATACGCCCAACCAAAGGCGTTGGCAGGGTTCATGGA
GGGGCCGGTGTACGCGGCGCCGGTGAGGACGAGGCTGACGGTGGAGACTGAGAGCATCGCTGTCTTGACGATGGGGTTGCGGGGTCCCTTGACGATGATG
CAGAGGACGGCAAAGGTGATGACGAAGGTGAGCACCCCTTCAGCGACGGCGCCGGTGTGGGGATCCACCTTGAGCGAGGGTCCGCCGAGCATGTGCTTGT
ACTGCTCCGGCATCAGCTCGGAGATGGCCAGAGCTCCGCCCACGGCTCCGGCGGCCTGCGCTGGTAGGCGGAGCGCGATGGAGAATAGCGAGGGGCTGGT
GAGGCCCGCGGCGTAGAAGGCGGCGACGCCGGTGGGGTTGAAGCTGGCGCCGCCGAGGGCGTCGCAGAGGAGGTTGAAGGCGAAGAGGAGGAGGGCGAGG
ATGGAGACGGTGACGAGGAGGGCGTAGTGGATCCCCTCGTGCAGGCTGAGGTAGGTGGTGACGGCGGCCGTGGAGGCGCCGAGCGTGGAGACGCAGAGCA
CCCAGAGGAAGGTCACGACGCCGTCCGCCGCCGCCTCCCGCACAGCCGTTCCCATCGCCATCCGAGCGTTCCTTCCGTGCTTGCTTCCCTCACTCCGTCG
TCGCTGCTGGCAGTGATTGGTGGGTTGGGTTGGGTGTATGTATGGGTCTGGCTTGGCACACAGCACAAG
page-top