Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1500
Contig Information
Length 802 bp
Tissue Seed DPA5
Clones 3 Clones [Download: CSV  ,  FASTA ]
whok11c20    rwhok10d16    rwhok11c20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative acyl transferase 4 [Triticum aestivum]
Score 991
Evalue 1.2129e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1500
TTGGCTGTCTCATTCTAAGAATGGTAACGTACTGCTCAAGATGGATGTAGAAACAAAGTAAGTAAATACAACGAAAACAGGTACAAATACAACAACATCT
GCAACAATATATCAACCAAACAGCCGCATCAGCAGAGCTCCACGATGCTTCCATCCCCACCCCCCTGCATGCATGCATGCATGCCAAGGTTCTCTCGGTC
GTCTGGCAAAGCAAAGCGAAGGAGCTCGCTCATGGCAGGTCCTCCTTCATGCCGCGGGCGAACTCCTCCGAGTGCTCCTTGGTGACGCAGCTGGCGAGCA
TCCGGGTGCCGTCCAGCGGCAGCGGCGCCTTGAGGATGACGACGGAGGCGATGAAGTCGTTGTTCACGAGCGGGCCGGCGAACATGGGCGGGCCGAAGCC
GTAGTCCACGTCGGAGAACCCCAGCTTGCTCCAGTCGGAGACGTAGATGGACTCGTAGTCGAAGCTCATCTGGAAGGGATCCTGCCGCGTCTCCTCCTTG
GCGAACTGGAAGAACTCCACCGCCATCCGCTGCTTTGCCTCCCGGATCATGTCGATCACCTCCATCACCGACGACTCCAGCACCTTCTTGCTGCTCCCGG
ACATCTTCACGGGGAAGATGGAGTTGCCGTAGTACCCGGCGTCCAGCTTCAGCAGGTGGCGCACGCTGGCGAAGAAGCAGAGCTTCACCGTGGCGTCCGG
CTCCAGGTTCAGCGCCCGGGTGCGGCACTGCCACAGCTTCGCCGTCAGCACGTCGAAGCCGGAGCAGAACTTGCCGCTGTGCGCCTTGTACTGCGTCTTG
AG
page-top