Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1452
Contig Information
Length 534 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10b11    rwhok10b11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HvB12D [Hordeum vulgare subsp. vulgare] >gi|3445292|emb|CAA70936.1| B12Dg1 [Hordeum vulgare subsp. vulgare]
Score 453
Evalue 1.17909e-43
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1452
CTTTCGTCTCTCTCACTCACTCTCCCCCTCCGCCGCCGGCGCAGCGTCCTCCCCGCGACTCCGATGGCCAGCAAGTGGGTCAGGCCCGAGGTGTACCCGC
TGTTCGCGGCGACGGGCGTCGCCATCGGCATCTGCGCCTTCAGCCTCCTCCGCAACATCACCGGCAACCCAGAAGTCAGGGTCAACAAGATGGGGAGGGC
AGCGGGAGTGCTTGAGAACCATGAGGAGGGCAGGCGCTACGCCGAGCATGGCCTCAGAGCCTATGTGCAGGACAAGACCCCCGAGATCATGCCAGGAATC
AACAAGTTCTTCACCAGCCCGAAATGAAGCACTTTAGCCTGTCAGTGGCTCGCTATTAGTAACTGTTGTGGTCAAGTGCAAACCTATTTCAAGCATTCAG
TAATGTTGTCGCGTCCATAATTCAGAGGATATCATCAAGTGCCTCTTATTGAAAGAAGCCATGTGATGTTTGATGGCTTGCTATATATGTGATGGTTGAT
GGCTTCTAAATATCTGTTTCATTGAAAAAAAAAA
page-top