Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1451
Contig Information
Length 476 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhok10b02    rwhok11o18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein TC0684 [Chlamydia muridarum Nigg] >gi|7190716|gb|AAF39501.1| conserved hypothetical protein [Chlamydia muridarum Nigg]
Score 74
Evalue 7.84635
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1451
AATAGTAGTACTCATCATGGGTGCATGGAACAACAGAAACTAAAAGGAATGGTGGAATACAAGGAATACAAAAAGATGCATCATCACTATCTCGCTAACC
GGATACTATGCCACTTATTCTAGAAATAGCACATCGTGGCTCCGGACGGGGTCGATCTCCTCCTTCAGCTGTCATATGTGAGTATCACATCAATTGTCAG
TCATCGGTGGCTTGCCCTTCGGAGGCGGCTCCGGCTTCGGTTCGGGCTCAGGCTTGGGCTCTGGCTTAGGCATAGGTTCAGGCTTAGGCTCTGGTTTAGG
CAATGGTTTGGGCTTAGGCTCTGGCTTTGGCATCGGCTCAGGCTTGGGCTCTGGCTTCGGNNCTGGCTTCGGCATTGGCTCNGGCTTGGGCTCNGGNTTN
GGTCCNGNCTNTGGCATCNGTCTCTGNCTTGGNCTCNGGCTTNGGCTCTGGCTTNGNNCCNGGCTTNGACATCGGC
page-top