Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1323
Contig Information
Length 1107 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10b13    rwhok10b13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0631700 [Oryza sativa (japonica cultivar-group)] >gi|113533179|dbj|BAF05562.1| Os01g0631700 [Oryza sativa (japonica cultivar-group)] >gi|218188711|gb|EEC71138.1| hypothetical protein OsI_02959 [Oryza sativa Indica Group]
Score 554
Evalue 1.4218e-100
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1323
TATTGGCCATGTCAGGCATAAAAATCTCGTCCGTCTGCTAGGATATTGTGTTGAAGGAATCCACAGGATGCTTGTGTATGAGTATGTGAATAACGGAAAC
TTAGAGCAGTGGATTCATGGCGCCATGCGGCAGCACGGTGTTCTTACCTGGGAAGCTCGAATGAAAATCATTCTTGGAATTGCTAAAGCGCTTGCTTACC
TACATGAAGCCATAGAGCCAAAAGTTGTGCACCGTGATATCAAATCAAGCAATATCCTAATTGATGAGGATTTTCAATGGGAAGCTTTCCGATTTTGGAT
TGGCTAAGATGCTGGGTGCAGGGAAGAGCCATATCACGACTCGAGTTATGGGAACTTTCGGGTATGTGGCCCCCGAGTATGCCAACACAGGTCTGTTAAA
CGAGAAGAGTGATGTGTACAGTTTTGGCGTGCTGCTCCTGGAAGCAGTGACTGGGAGGGATCCTGTTGACTATGGTCGGCCAGCTAATGAGGTGCATCTG
GTGGAGTGGCTCAAAATGATGGTCGGCACAAAGAGAGCCGACGAGGTGGTGGACCGTGACATGGAGGTGAAGCCAACCATCCGTGCTCTCAAGCGCGCCC
TCCTAGTGGCGCTGCGGTGTGTCGACCCGGACTCCGAGAAGAGACCCACGATGGGTCACGTCGTCCGGATGCTCGAGGCAGAGGACGTCCCGTCGCGGGA
GGACCGGAGGAGCCGGAGGGGCGGCCATGCCGGTGGTGGCAACGCGGACGCCGAGTCCAAGGCGAGCTCGAGCGAGTTCGAGGTGAGCGGCGACTCGGGG
CCCTCGGCGAGGTTCCAGCCATGAAGATCGGCGTCGACGAACGAGGGCGTCCCCGAGAACTCGGCTCCGGCCGAGGGTAGTAGAGATAGCATGATGAGCA
TTTCCTGTAGGACATTGCATTGCGCTTCATTTTGCATTGTAGGCGGTAGAGAAAGAGCAGTGCTGATTGATCATGCGTGATCATCATCCCCTGAGACTGA
GACCTTTGTTCTAGCTTCCTTTCGGCACCCTGTACAGATTGTTTCCTCCTTTCTTTTCTGTTTTCTTTGTCTAGGGTATCTCTTGAACAATAAATAAACC
TATAAGA
page-top