Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1278
Contig Information
Length 562 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10e14    rwhok10e14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 198
Evalue 5.01927e-14
Total Hit Count 33
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1278
GATTCGCAGAGCTCGAGAGAGTGCGACCAAAATGGCGATGAGATGCGCGCTGACCTCGCTCCCCGCGCGCCTCCGGTCCCCGGCGGTGGTAGCCAGCGGG
ACGCGGCGCCTTCTGAGTGACGGGAAGGGGCGCGTGCTCAGCGAGGAGGAGCGCGCCAAGGAGAACGTCTACATCCAGAAGATGGAGAGGGAGAGGCAGG
AGAAGCTCAAGAAAAAGCTCGAACAGGAGAAGGATGCGGCCGACAAGGCTAAGTCCGGCGCCGACGGCAAGAAGGCCGAGGGAACTAACTAGGAGCGATC
TTCGCCTGCCTGAAGGTGACCCCATCTTGGACGCATCTGGGGGACATTTGTGTTTATAGATGTCCAGAGATGGAAGAATAAATTCTGTAAAGCGTTGATA
GCGCTATCTTTGCTTTGTTTTCGGTTTGCCGCGCTTGTTCAGGATATAATCCAGGGACCATAAACATTGATAAACTGGGAACTTTGTATCGTTGCTGGAC
CAAATATTTGTCGCCCTTTTGCGCATTTGGTTGTATGGTATGGGTCACCACCAAAAAAAAAA
page-top