Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1267
Contig Information
Length 619 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10e17    rwhok10e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LELG_00051 [Lodderomyces elongisporus NRRL YB-4239] >gi|146447485|gb|EDK41873.1| hypothetical protein LELG_00051 [Lodderomyces elongisporus NRRL YB-4239]
Score 76
Evalue 8.94688
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1267
CCAGTCCAGACTCCACGCCGACACCGATGAAGACGAAGTGGACGAATGGCCTGACGATGACTCAACCGAGGAGCCCGAGGCGGTAGCGGCAGCAAGCAAC
AGGGCTTCGCTGGGGCGGGAGGAGGACGTGTCGTTCAGCGACCTGGAAGACGACGACGACGACGACGGCGGCAATAAAGGGTCGGGCAAGTAGCTAAGAT
AATTTCTAGGTCCGGTCCCGGCACAATCATCCGAGCCTCCATTGGAGCAGTCCCACAAGCACACGCTCGCTGGCTTCACTCAAGGGACTACAGAAGGCAG
CGGTGGATGATTACGCGGTCATTATTAGTCTCCCTCTTGAGAGGCGATGATGATGGATCGTGGAAGCTGGCTGGCTAGCTGGGCCTCCCTCGACTGGCCT
GAATTAGAAGAGAAGCACAAAACCAATAATGATGGCAAGCAAGTACGTACATCTGTATCGTTTGGCCTGTTTCTGTACATAGAGCCCCCTGGTGCGGGGC
TGCATCCTGTATGAACCAACCTGGCAACGTACCACTCTGGCCGTCCATCTGTGTGGGCATAATGGTGCAGGTGCGCGCACTCAATAAATCGCTCGATTAG
CTGAAAAAGAAAAAAAAAA
page-top