Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1262
Contig Information
Length 658 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10f13    rwhok10f13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0805000 [Oryza sativa (japonica cultivar-group)] >gi|55296824|dbj|BAD68168.1| putative plastid ribosomal protein L34 precursor [Oryza sativa Japonica Group] >gi|113534087|dbj|BAF06470.1| Os01g0805000 [Oryza sativa (japonica cultivar-group)] >gi|125528074|gb|EAY76188.1| hypothetical protein OsI_04121 [Oryza sativa Indica Group] >gi|125572355|gb|EAZ13870.1| hypothetical protein OsJ_003695 [Oryza sativa (japonica cultivar-group)]
Score 292
Evalue 9.24522e-25
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1262
CTCCAACTGCCCAGACATGGCGCTTGCCCTCGCCTCCCCAATGGCGTCCCTCTCGCTCCACTCCGGGAGGATCTCGGCGCTGGCTATCGGCGGCGGTCTC
CGCCCCCACAAGGCGGGCCCTATGGGGGCCTCCGCATCCCCGTTTCTCCGGAGCTCATTCATCTCCTCTTCCTCCACCTCCTCCGCCCCCACCTCCTCGC
TCTCGGCTGCGGTCTCGGCGTAGCTCGCCTTCACGTCCGCCTCCTCGTTCGGCGGTTCATCTTTGGGAATTGAGTTCAGCTACAACAGATTAACAACACG
CAGACCCCGCGGTCTACAGATTAGGGCTGGAAAGGCTGCCCTCTGCCTGACCAAGAGGTCAAGATCTAGGAAGTCACTTGCCCGTGTGCATGGTTTCCGA
AAGCGGATGCGGACTACTGCTGGAAGAAAGGTTCTGAAGCGTAGACGTGACAGAGGAAGGAAGATTCTCTGCACAAAGTCGAACTCACCCACTGGGACAA
AGTATTGATTAGCAGTGTAATGTGAGGCATTATGTATTCCAGCTGTAAGTTTACTCTTTTTGCACCCCATGTTCTCAGCCATGTTCATCTGTAACAATTG
CTGCACATCTTTTCCCTGTACTTTGGTTAATAACTTGATATCTGAACTAAAAAAAAAA
page-top