Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1261
Contig Information
Length 1009 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10g01    rwhok10g01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_000172 [Oryza sativa (japonica cultivar-group)]
Score 830
Evalue 8.41012e-87
Total Hit Count 224
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1261
CCTTGGGTCATTCTGAATCGGAGGTTTATAGAGTACTGCATTTTCGGATGGGAGAACCTCCCTCGGACCCTTCTCATGTACTTCACGAACGTGATGTTGC
CTCTGGAAGGTTATTTCCACTCAGTCGCATGCAACTCGGACTTCCGTAACTTCACGGTGAACAATGACTTGCGGTACGTGGCATGGGACGACCCACCTCA
GATGGAACCCCGGTTTCTAAACATTACACATTATGAGGAGATTGTGGAGAGCGGAGTGCCCTTTGCTAGGAAGTTCCGAGAGAAAGAGCATCTGTTGGAC
AGGATTGATGAGAAAATACTCCAGCGATGGCGTCACAGACCTGTTCCCGGAGCGTGGTGCACAGGCAGGAAGAGGTGGTTCAGCGATCCATGCTCCCAGT
GGAGCAACGTCAACATCGTAAGACCCGGCCCCCAAGCCGAGAAGTTCCGCAGATACATGGACCGGATCCTGGAAGAATCCAAGTCAAGCAACAGCTCATG
CGCGCAATAGCAGCACTGAACCGCGAGGCTGCATGCACTTTCCGGCAGTCGAGCGCGTCTCATTTTGCACAGATCGAGTGGCTCTCCACGTGTTCAGAAC
TCCGGCATTTCCGCCTCCCGTGGGAGCATTTTTGCTGCAGCTGGGTTGTGCGCACAGGGCCAAGGTGAGGGGCGTGCCTATTCTTTCAAGATTTTTTGGT
GACTCTGATGGCTTCAAGTGCTCACTGCTCCCAGCATTGTTGGAGGCCAGGGAGCTTTCGGTGGGGGATTTTACCTGAGCTTGTAGGGAGTGTAATTAGT
AGCGATCAGTCGAACGACCTTGTGAGGATGTTTATAGAACCTTTGGTGGAATTCTTGGTGCTCCCATACGGAATTGAATCGAGAGGCAGGCAAAAAAACA
TGAAGGGTGGGGAATTTTGTTGGCCTTGTGGTTGTGGATTGGTAGCTGTTGTGGTTTACAGAATGCTCACAGACTCTTTTTACTCCTCTCGAACTGCAGA
GGAAGTCCA
page-top