Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1253
Contig Information
Length 966 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10f08    rwhok10f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24143 [Oryza sativa Indica Group]
Score 920
Evalue 1.10235e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1253
CATGGTGGAGGCGAGGCTGCCGCCGGGCTTCAGGTTCCACCCACGGGACGACGAGCTCGTGCTCGACTACCTGTCCAGGAAGCTCGGCGGCGGTGGCGCC
GGAGGGGCGGCGGCCGCGGTGGCGAGCATCTACGGCTGCCCCGCCATGGTCGACGTCGACCTCAACAAGATCGAGCCCCTGGGACCTCCCCCGAAATCGC
ATGCATTGGCGGCAAGGAGTGGTACTTCTACAGCTTAAGGGACAAGAAGTACGCTACAGGCCAGCGAACAAATAGAGCAACTGAATCAGGCTACTGGAAG
GCCACAGGGAAAGACCGTGCGATAAGCCGGAAAGGGTTGCTAGTTGGCATGAGAAAAACCCTGGTGTTTTATGAAGGTAGAGCCCCTAAAGGGAAGAAGA
CTGAATGGGTCATGCACGAATTCCGCAAGGAAGGGCAAGGCGATCTGATGAAGTTGCCACTCAAGGAGGACTGGGTCTTGTGTAGGGTTTTTTACAAGAC
CAGGACAACCATTGCCAAACCATCCACAGGGAGCAACTACAACATTGACAGTGCAGCCGCAACCTCACTGCCTCCTCTCATTGACAACTACATTGCCTTT
GACCATCCTGGAATGTCCACGGTGCAAAACCTAGAGGGTTATGAGCAAGTGCCCTGCTTCTCCAATGGCCCCTCCTCTCACCCGTCGTCGTCGGCCTCGA
TGAACATCCCGGTGATGGCGATGGCGCCCATGGCTGCCGATCAGGAGCAGCAGCACATGGGGAAGGCGATCAAGGACGCGCTGAGCCAGCTCACCAGGTT
TGAGCAAGGCAACGTGAAGAGGGAGGCGCCTGCCCAGGGTGGTGTGTTTGCTCAAGATGGGTTCGAGTACTTAGCTGAGAGTGGCTTTTCACAGATGTGG
AACTCACTCAGTTGATTTTCTAGCTAGGGGTATTATTGCTAGTGCTACCAATCAAAGATCTACATT
page-top