Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig29
Contig Information
Length 1080 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl54b06    rwhfl54b06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RAR1 [Triticum aestivum]
Score 1001
Evalue 8.89046e-126
Total Hit Count 223
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig29
gggtcggtccggaagagtcgagaaactcgagataccttgccggctgccgcagcctgcccccgtcgtctttcttccgtgcgccgaaacagggtccacccaa
gagcgagagggggagaaggcagaaatctcgagagagaaacgcatcgcgatgtcggcggagacggagacgagcgcccgccgcgccggcgcccgcgcccatg
cggtgccagcgcataggctgcgacgccatgttcactgacgacgacaaccccgacggctcctgccactaccacccctccggacctatgtttcatgatggca
tgaaagaagtggcgctgttgcaagcaaagaagccatgattttagcttatttttggctattcCTGGATGCGCCACAGGGAAGCATACAACTGAgaaaccaG
TCACAAAAGCTGTTTCTCTTAACTCAAAGGCAACCCCACCAAAGTTAGCTCCAATCCAGTCTTCTAAGCAGGGTGTGGAAACCGAGGCCTGCTCCAGGTG
CCGTCAGGGTTTCTTTTGCTCCGACCATGGATCACAGCcgaaggcacaaaaaccagttgctgtaaatggtacaaatacggaacctgtcgaaaaatgctca
gttccacagcccaggaaaaaagttgttaatataaatgagcctagggtttgtaagaataaaggatgtggtaaaacctacaaggagaaggataaccatgatg
ctgcatgtgaataccatccaggtcctgcggttttccatgacaggaatagagggtggaagtgttgcgatatccacgtcaaggagtttgacgaatttatgga
gatacctccgtgcacaaaggggtggcacaatgccgatgctgtgtgagttcacaccatgactcttgcattaagagttatttgttgtagtatctcctcgtgc
ataaggttggcatcttgccgcaatttctggagaactgtgcttggaagtgtgacctgatattcaagaatgggcctgcttgagtgtgctctgattaactacc
gtcgaaatctcatgtgatgtttcatgtaatctggaatcggaacttgaaaccatatgtggacatttagtaatttaactacg
page-top