Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1101
Contig Information
Length 700 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10e06    rwhok10e06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216924 [Zea mays] >gi|194697072|gb|ACF82620.1| unknown [Zea mays] >gi|195621176|gb|ACG32418.1| cytochrome b5 [Zea mays]
Score 650
Evalue 3.24058e-66
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1101
CAGAGAGAGGAGGAGGAGGAGGAGGAGGAGGAGACCATGTCGTCGTCCGGTGGCAAGCTCTTCACCCTGGAGGAGGTCGCCAAGCACAGCTCCAAGGACG
ACTGCTGGCTCGTCATCGGCGGCAAGGTGTACAATGTGACCAAGTTTCTTGATGACCACCCTGGAGGCGACGACGTCTTGCTGTCTTCAACTGCCAAGGA
CGCGACCGACGACTTCGAGGACGTGGGACACAGCACAACCGCCCGGGCGATGATGGACGAGTACTACGTCGGCGAGATCGACGCGACCACGATACCCACC
AAGGTCAAGTACACGCCGCCCAAGCAGCCGCACTACAACCAGGACAAGACCCCCGAGTTCGTCATCAAGATCCTCCAGTTCTTGGTCCCCCTCGCGATAC
TGGGCCTGGCCGTCGCCGTACGGATCTACACCAAGGCAGACTCTGTCTAGCACCGTCATCTTATACCAGTCAGTCAGTCATTCGGAAGTGTCCAAGAGCT
GAATAAGTTTTAGTGGGGATTTGCATATTTTGTACCAGCGTCACCGTCCTGTCATGGAATCTGGGAACTGCTCTCGACCCGTCGTTGCGTTATGGTTCTA
CTAAGACGTCCGCTGTTGAATCGTGACTCGGGAAAAACGGATAGATACTTGGCTATATTTTCCAAAAAAAAAAANAAAAAAAAANNNCCCAAAAAAAAAA
page-top