Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1081
Contig Information
Length 666 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10e05    rwhok10e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.1
Score 404
Evalue 9.84403e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1081
AAGGCGGTGACCCGGTCCACCAAGGCCGGCCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTTCCTCAAGAAGGGCCGCTACGCGCAGCGCGTCGGCTCCG
GCGCCCCCGTCTACCTCGCCGCCGTCCTCGAGTACCTCGCCGCCGAGGTGCTGGAGCTCGCCGGCAACGCCGCCAAGGACAACAAGAAGACCCGCATCGT
GCCGCGCCACCTGCTCCTCGCCATCCGCAACGACCAGGAGCTCGGCAAGCTGCTCGCCGGCGTCACCATCGCGCACGGCGGCGTGATCCCCAACATCAAC
CCCGTGCTGCTCCCCAAGAAGGCCCTCGAGAAGGCCGAGAAGGAGTCCCAGTCGCCCAAGTCGCCCAAGAGGAAGGCCCCCGCCCCCGCACCCGCCGCCA
AGAAGACCCCCAAGAAGACCGCCGCCGACAAGAAGACCGCCGCCGCCGACAAGAAGACCGCCGCCGCCGACAAGAAGACCGCCGCCGCTGACAAGAAGAC
CGCCGCCGCCGACAAGAAGGCTGCCGCCGACGCCGAGGAGGAGGCCGCCGCCGACGAGTAGACAGGGCAAAGTTGCGTCGCGTAGTTCTGCATCTGAGAG
GGGAGAGAAAGAGAGAGAGCATGGGATCCTGTATGTAATGCCTGGTCTGGAGTCCGAACTGGTGGT
page-top