Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1055
Contig Information
Length 701 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10e03    rwhok10e03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.1 >gi|21801|emb|CAA42530.1| histone H2B [Triticum aestivum]
Score 459
Evalue 4.55343e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1055
CACCTTCCGGCGGCGAAGCAACCCACCCACTTTTCTCCCCCTCCCGAAGCAGCGATGGCCCCCAAGGCGGAGAAGAAGCCGGCGGCGAAGAAGCCCGCAG
AGGAGGAGCCCGCGGCGGAGAAGGCCGAGAAGGCCCCGGCGGCGAAGAAGCCCAAGGCCGAGAAGCGGCTGCCGGCGGGCAAGACCGCCTCCAAGGAAGG
CGGCGAGAAGAAGGGCAAGAAGAAGAGCAAGAAGAGCGTCGAGACCTACAAGATCTACATCTTCAAGGTGCTCAAGCAGGTGCACCCCGACATCGGCATC
TCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGGGAGGCCGCCAAGCTCGCCCGCTACAACAAGAAGCCCA
CCATCACCTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGGGAACTCGCCAAGCACGCCGTCTCTGAGGGCACCAAGGCCGTCACCAAGTT
CACCTCCTCTTAGACTGCGTCGCCTGTATCTAGTAGCAAATGTAGTTCTATACTGTTGGCTTAGTGCTTGTCCGTGGACTCTGGTTATCTGCAAGTAATA
GTAGTCCTACTTTTGGATGAAAATTGCCGAATCATTGTAAATGCTTTGTTGGCTCGTCGGCCACCTGCAAGAACTGAATTATGTCCGCTTCNNNAAAAAA
A
page-top