Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig649
Contig Information
Length 719 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10b14    rwhok10b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0926600 [Oryza sativa (japonica cultivar-group)] >gi|20160727|dbj|BAB89669.1| P0482D04.16 [Oryza sativa Japonica Group] >gi|20805225|dbj|BAB92892.1| putative pectin-glucuronyltransferase [Oryza sativa Japonica Group] >gi|113534794|dbj|BAF07177.1| Os01g0926600 [Oryza sativa (japonica cultivar-group)] >gi|125528941|gb|EAY77055.1| hypothetical protein OsI_05013 [Oryza sativa Indica Group] >gi|125573177|gb|EAZ14692.1| hypothetical protein OsJ_004517 [Oryza sativa (japonica cultivar-group)] >gi|215687152|dbj|BAG90922.1| unnamed protein product [Oryza sativa Japonica Group]
Score 628
Evalue 1.22037e-63
Total Hit Count 468
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig649
GGAGCCCCCGTCTCGTGGAGGCCGTGGTGTTCGGGTGCATCCCGGTGATCATCGCGGACGACATTGTGCTGCCCTTCGCGGACGCCATCCCGTGGGATGA
GATCGGCGTGTTCGTCGCGGAGGACGACGTGCCCAAGCTTGACACCATCCTGACCTCCATCCCCATGGAGGTGATCCTCCGGAAGCAGCGGCTGCTGGCG
AACCCGTCGATGAAGCAGGCCATGCTGTTCCCGCAGCCCGCGCAGCCCGGTGACGCCTTCCACCAGATCTTGAACGGGCTGGCGCGGAAGCTCCCGCACA
GCAAGAGCGTGTACCTGACCCCGGGGCAGAAGGCGCTGAACTGGACCCAGGGCCCCAAGGGCGACCTGAAGCCATGGTAGGTAGCCGCGGCACCGGCATT
GGCGCCATGAGCTGATGATGTTCAGTCGGTCTGAACCAGCTGAGAGGACTGATGGATGAGTAAGCCCAGCCAAAACCAAGCCAAGCTAAGCCATTACTGT
CATCAAATGTAAAGCTCCTTCCTGTCTAATACCTTGCTTCTTTTTGTTGTGATGATGTGCCTGCCTACCTTCCATGTTATGGCATGGCATGGTTCCCTTG
TTTTTTGTTGCCCTAGTGCTAGACTGCTGCTGTTGTAGGTGATCATGGATCATAGAGTGTTATATATATGCATGACCTTTGTATTATACTGCTATACAGT
AGATGCCGATCTTAATGCG
page-top