Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig632
Contig Information
Length 1341 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10d17    rwhok10d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_033561 [Oryza sativa (japonica cultivar-group)]
Score 112
Evalue 0.00229479
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig632
AGACTGCACTTCAGAATGTCCGTGTCATCATCTTTGACGTGAGAGGCGGAGGGCAAGAATTGCGCTCTATGGTCAATAGAAGGATGACCCGTCACCGTGC
CATGGCTCTGCTGGTGTACATGGGTGTACCGGTCACCCCGGCTCCCAATCCCTTCAACCTACCTTCCCCGGGCCATAGCTATCATATCATCCGGTTGATA
GACCCTTACCAGCCGCAGCTGCAAGTGGATTTGCTGATTAGAGATACTGACTTATACCTTGTCGCATTTCGCCGTTCACTCGATGACAATTGGGGCAATT
GGTATAGATTCAGTGATCAACAAGTACCTAGCTTTATTGTTGCTCTTGATTTGGGTTTCACTTCCAACTATTCTCGTGTTCCTGGCAGCATTCCGACAGT
AGGTGGTCCCGAGGACATGGTTTTTATCTTCAACACCTTGGCACGCCATGAGGACAGGTTGAGGTTGGGTGATTCCTGCAGTCCAGAGAACTCTGCACAT
TGCTACAGTCCTGAGAGCTGTGCAGAATGCTGCAGTGGTTTTCTGTGAGGTTATGAGATTCATTGCTGTTTTGCTCGAGATGGTCCGTAGACTGGAAGCA
GGGGAGGCCGCGTCTGTGTTGCCTGGGGAGATGTGGGATATGATTACCTCGTGGCATGTGGATTGTTGGTTTATCCTTGACGTGAGGAGGCGATTGGCGT
TACCCGCACATCACTGGGAAAGCCATGTTAATGAGGTTGACAGACAGAGATTCGATCAGCTGATCAACCGTGTGAGTGTCATCATCTACATTCCAGAGTT
GTTCACTTCTGATACACGGCGGATGACTCGACGGCAGGAGAATGAGGTGCGCAATATCCAGGATCCAGGTTTTCCCGCTGCAGATGCTTAGAGCCTGTTC
GGCAGCTCTCCGCTCCTGGAGCGGCCAGAGCATCATCGAACAAATCAGCTCCACGCTTTCCTCGTCCCGGAGTGGAGCGGTCCGCAGGCCATTTTCTCGG
AGCCCCCGTATTTCGCGGAGCTGGTGAATTGCCGAACAGGCTCTTAGTGTCATATCATGCTGTTCCAGGTCCTTGAGGGCTATGCTGATCTTAGTGTTAG
CACTGCTGCCTATAAGTAATTTTGTGTTGTATTTGCAACTGCTGTTACTATTAGCATAGACCATATAGGGTGTGGTGTCCCGTGACATCTTTGTGCTAGG
GTCATTATGTCTTGTGGTAGTTGATGTAGTCGCTGAGTTGCGTCTGGTCTTGATGATGAAACGTTTGGGATATTCCCCGCTTAATCCACTTGCAGTATCT
CTATACATCTGTAAATAAGCTGCAGATGTCCAAACAAACAC
page-top