Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig438
Contig Information
Length 927 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10c14    rwhok10c14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit FD-like 6 protein [Triticum aestivum]
Score 1030
Evalue 4.7087e-110
Total Hit Count 367
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig438
ATGAGAAGAACCTTCCATTACCAAATGGCGCTGGGAATTCAGGCAGTCACAGCACGTCAGCTTTTGGTTTGGAACGTCAGGGCAGCAGCATTACTGTGCC
CCTGCCGTTGAGCAAGAAGACAGTGGATGAAATTTGGAGAAACATCCAGCAGGAAGAGGAGAGTAGTGATGACGAGAAAAGGAGTTCAGGTTGTGAGGCA
CAGATGTCGTTTGGGGAGATAACACTTGAGGAGTTCTTGCAAAGGGCTGGCATTGTTACCGGGCAGTATCAGAAGGATGCTGAGGAGTTAATTGATCTTG
TAGGAACTGGAGAAAGTGCTCATTTGATGACCAGAGTGCAGGATTTCCCACAGGGAACAAGTGCAATTGATGCGTATATTGTACGTCAGTCAATTGCGCA
ACCGCTGAGTGTTGCAATCCCTTCGACAATGGATTCCATCTACCCAGATCGTCAAATGAGTATTTCGTCATCTCTAGAACTTTCTGATCTTCAAAGTCCT
AGTCATAAGAGAATGTCTTCCCAGGATGTGGTATACAAGGTTGCTGATCGGAGGCAGAAGAGGATGATCAAGAACCGAGAATCGGCTGCACGTTCAAGAG
CTAGGAAACAGGCCTACACAAACGAGCTCGAATGCAAATTGTCTTGTCTGGAAGAGGAGAACAAGAGGCTGAAGAGAGAGAAGGAGTTGGACATGTTATT
GAAGTCCGCGCCCCCTCCAGAACCGAAAAAACATCATCGGAGAACGAGATCGACCTCATTCTAATTGTGTGTAGAGTACAGGCCTCTGGTAGATTTTGAT
CACCCTTTTGCTTTCTCCTCGCATGTAACTATGGAGCGTGTGCAGTTTGCTTTGCTTGTAATTTGTAAAGGCCTAGGGCACCCAACAATCTTGTGAAATA
TCCTCCCGGCCGTTAGGTTTCAGATTG
page-top