Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig279
Contig Information
Length 1299 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10d08    rwhok10d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit geranylgeranyl-diphosphate synthase [Zea mays] >gi|1346033|sp|P49353|FPPS_MAIZE RecName: Full=Farnesyl pyrophosphate synthetase; Short=FPP synthetase; Short=FPS; AltName: Full=Farnesyl diphosphate synthetase; Includes: RecName: Full=Dimethylallyltranstransferase; Includes: RecName: Full=Geranyltranstransferase >gi|33340602|gb|AAQ14871.1|AF330036_1 farnesyl diphosphate synthase [Zea mays] >gi|662368|gb|AAB39276.1| farnesyl pyrophosphate synthetase >gi|194702348|gb|ACF85258.1| unknown [Zea mays] >gi|194708184|gb|ACF88176.1| unknown [Zea mays] >gi|195623932|gb|ACG33796.1| farnesyl pyrophosphate synthetase [Zea mays]
Score 1015
Evalue 2.05017e-170
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig279
CTCTCCCTCCCTCCCTCTCGGCCGATTTACTCCCTCCTCGGCTGCCCTGCCCTCCCCTGTTTGAGGCAATGGCGGCGGCGGCGGTGAACGGCGGGGGCGG
GGAGAACAAGGCGGCGTTCGCGCGGATCTACGACGCGCTCAAGGCGGAGCTGCTCAGGGACCCCGCCTTCGAGTACACGGAGTCGTCGCGCCAGTGGATC
GACCGCATGCTGGACTACAATGTACTGGGAGGAAAGTGCAACCGTGGGCTCTCTGTGGTCGACAGCTATAAGCTGTTGAAAGGCGTCGATGTTCTTACTG
AGGAGGAGATGTTTCTTGCCTCCACTCTCGGTTGGTGCATTGAATGGCTTCAAGCCTTCTTTCTTGTGCTCGATGATATCATGGACGACTCCCACACTCG
ACGTGGGCAGCCTTGTTGGTTTAGGGTGTCTCAGGTTGGCTTGATTGCTGTAAATGATGGGATTCTCCTTCGCAACCATATTTCGAGAATGCTTCGGCTC
CACTTTAAGAAGAAGCCTTACTATGCCGATCTCCTTGATTTATTCAACGAGGTTGAGTTCAAGACAGCTTCTGGTCAAATGCTGGACCTTATTACAACCC
ACGAGGGAGAAAAAGATCTAACGAAATATAACATTGGAGTCCACCGCCGAATTGTTCAATTCAAGACAGCCTACTATTCATTTTATCTGCCGGTTGCATG
TGCGCTGCTACTCTCCGGCGAGAGTTTGGAGAACTACAGTGCTGTAGAGAACATACTTGTTGAGATGGGGAACTTACTTCCAAGTTCAGGATGATTATCT
AGACTGTTATGGTGATCCTGAATTTATTGGCAAGATTGGCACCGACATTGAAGATTACAAGTGCTCCTGGCTAGTTGTCCAAGCTCTTGAGCGTGCTGAT
GAGAGCCAAAAGAGCATTCTATTTGAAAACTATGGAAAGAAAGATCCAGCATGCGTGGCAAAAGTGAAGGATCTCTACAAAGAACTTAACCTTGAGGCGG
TATTCCATGAGTACGAGAGCGAGAGCTACAAGAAGCTGATTGCTGATATCGAAGCCCAGCCGAGCGTTGCCGTTCAGAAGGTTCTGAAGTCCTTCTTGCA
CAAGATCTACATGAGGCAGAAGTAGGGGGTGTCTCTTGGGCAGGAAATATGTTCCATTGTGGCATGTTTGATAGATGACTAGTGGTGTTGATTTTATGGT
TTAGTGCTTCATGTTGTATGTTGCGCCTTGCTGCTCCCAGTAATAATAATGATGCAAGGCGCTATTTTGGGTTTGATGGACCGCTTTGGTGTAGACGAC
page-top