Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig28
Contig Information
Length 1115 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl54i05    rwhfl54i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha-soluble NSF attachment protein [Zea mays]
Score 1332
Evalue 6.03069e-145
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig28
gccgccggcacaagcgatcggagcagcggcccgtcggcagcgatgggggaccacgaggctcgcggtgacgacacggagaggaaggcggataagaagctct
ccggctgggggcccttcggctccaagtacgaggacgccgccgacctatacgataaggccgccaactttttcaagctctcgaagaactggaacagagctgc
atctgtgtatatcaagattgctaattgccatatgaagggtgatagtaagcatgaagctgcctcagcttatgtggaagctgcaaactgctacaaaaaattc
tcacctcaggaagctgcgcaagcgctagaccaggctgttaatctttttctggaaattggtAGATTGAGCATGGCTGCAAGATACTGCAAGGACATTGGTG
AGATTTATCAGCAAGAACAGGATTTGGAGAAGGCTTCAGATTACCTAGAAAGGGCCGCTGATCTTTTCGACAGTGAAGGACAGACATCTCAATCAAACAC
CATTAAGCAGAAAGTTGCAGAAATTGCTGCGCAGTTGGAACAGTACCCAAAGGCAACTGAGATTTTTGAAGAAATTGCTCGTcaatcaattaacaacaat
ctgctgaagtatagtgtcagaggcatcctccttaatgcaggaatctgccaactatgtagagctgatgctgttgctatacaaaattcgttggagagatacc
aggaaatcgatccgactttctcaggaactcgtgaatacaaacttttagctgatcttgctgcatcaatggacgatggagatattgccaaatttactgatgc
catcaaggaatttgacggcatgacacgcctggatccttggaaaacgacactgctgctgagggcaaagaatgagctgaagaaacaagaggatgatgaggat
gatctaacctaagccttattgtaaaaactctttgatgcttcaacatggtgtgatttatgcctctatttcgtcttggaggtacatataatgggcataatga
agatccaccttttggttgtatagaacttcattttgaagtaccatatcgggtgtcgtgtgtcatttgttcttgtcatgacttggttttccgtccgaatgaa
aataccatagcacgc
page-top