Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig153
Contig Information
Length 599 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6g16    rwhok6g16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194345 [Zea mays] >gi|194695580|gb|ACF81874.1| unknown [Zea mays]
Score 601
Evalue 1.09957e-60
Total Hit Count 349
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig153
CGCCGCCGCCCCCTGCACCAACCAGCGCCCTGCCGCCGCCGCCGCCGGAGAAGGAGAGGGAGCAGCCGCAGCCATGGGTCGCGTCCGCACCAAGACCGTG
AAGAAGACCTCCCGCCAGGTCATCGAGAAGTACTATTCTCGGATGACCCTCGACTTCCACACCAACAAGAAGGTGCTCGAGGAGGTCTCCATCCTCCAGT
CGAAGCGCCTCCGCAACAAGGTGGCCGGCTTCACCACCCATCTGATGCGCCGCATCCAGCGCGGCCCCGTGCGCGGCATCTCCCTCAAGCTGCAGGAGGA
GGAGCGTGAGCGCCGCATGGACTTCGTGCCGGAGAAGTCGGCGCTCGAGGTCGACGAGATCCGCGTCGACAAGGAGACCATGGACATGCTGGCGTTCCTC
GGCATGGCCGACCTCCCCGGCGTCGAGCGCGCCCCCGAAGTCACCTCCTCCGCCGCCCCCTACCGCCAGCCGTTCAACGGGCCCCGTGGTGGCAACCGCG
CCTAGGTTCCTCCGCATCGTCGTCGTACCCCTATATTATGCTTTATGTCATTTAGATCTGTTACTTGTGGCAAGTAATGTTTTGAACTCAGAGCTAAGT
page-top