Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig98
Contig Information
Length 1052 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6k21    rwhok6k21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP-dependent Clp protease proteolytic subunit 1 [Zea mays]
Score 1119
Evalue 2.74457e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig98
GCCCAAACCCCCACCGCGAGCTCTCTCCCCGCCCCACCCATGGCGACCTCCACCGCCTCCTCCTCCTCCCTCACCGCCCCTCTCCTTGGCCCCAAACCCA
GCCCGAATCCGCCCCCCAGATCCCTCCCGCTCCTCAGGAGTCGGAGGTGCGCTCGGTCCGTGGCCGCCTCTGCCGGCGGCGGCGGAGTGGGACTCCACGG
GGCTGCTCACAGGCGCGGGATTTGGTCGATCAGGGATGACTTGCTGATGCCTAGGTCGCCCTACTTCCCAGTGGAGGCCGCGGGGCAGGAGCGCGGGCCC
TCCCCCATGGTGATGGAGCGGTTCCAGAGCGTCGTCAGCCAGCTCTTTCAGCACAGAATTATCCGATGCGGCGGTCCTGTGGAGGATGATATGGCCAACG
TCATTGTTGCGCAGCTGCTATACCTGGACGCCGTTGATCCTAACAAGGATATCATTATGTATGTGAACTCTCCAGGAGGGTCAGTGACAGCTGGGATGGC
CATATTTGATACAATGAAGCATATCAGGCCTGATGTTTCCACAGTTTGTATCGGACTTGCTGCAAGTATGGGTGCTTTCCTACTCAGCGGCGGGACGAAA
GGGAAGAGGTACAGCTTACCTAACTCAAGAATAATGATCCATCAGCCTCTTGGAGGAGCCCAAGGACAAGAGACCGACCTTGAGATCCAGGCCAATGAGA
TGCTGCACCACAAGGCCAACTTGAACGGATACCTAGCATACCACACTGGGCAGCCCCTGGATAAGATCAATGTAGATACTGACCGTGACTTCTTCATGAG
CGCGAAAGAGGCGAAGGAGTATGGCCTTATCGACGGAGTAATTGTGAATCCTCTTAAAGCACTTCAACCACTTCCAGCTTCCAGTTAGTCATGTCGTGCA
CAATCTCTGCCGCTCCAAGCATTTTTGTTGTGATCTTCTGGAGCTGTGTTTGTACCACGTTGTTTTCGTTAGTCTGGCTAGATGCTGTAATTTTGCATCA
TGAAGCTTCACAGGTTGTGCAGAACAGATGCACTACTAGAATATTCATCATT
page-top