Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig97
Contig Information
Length 846 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7m02    whok16i15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Tubulin alpha chain >gi|20413|emb|CAA47635.1| alpha-tubulin [Prunus dulcis]
Score 1163
Evalue 1.53238e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig97
GGCGTCTTCGTACTCGCCTCTCTCTCGCGCTTCCGAGCTTTGGCCTCCGTCCTCCCCTCCTCCCCCGATCTCTCCACCAGCGCAGCGTAGCGCCGGCTTC
CGCCGCTCCGACCCGCCGCCATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCCGGTATCCAGGTCGGGAACGCGTGCTGGGAGCTCTACTGCCTCGA
GCATGGCATTCAGCCTGATGGACAGATGCCCGGTGACAAGACCGTTGGGGGAGGTGATGATGCTTTCAACACCTTCTTCAGTGAGACTGGTGCTGGGAAG
CATGTCCCCCGCGCGGTCTTTGTTGATCTTGAGCCCACTGTGATTGATGAGGTGAGGACTGGCACTTACCGCCAGCTCTTCCACCCTGAGCAGCTTATCA
GTGGCAAGGAGGATGCAGCCAACAACTTTGCCCGTGGTCACTACACCATTGGCAAGGAGATTGTTGACCTATGCCTTGACCGTATCAGGAAGCTTGCAGA
CAACTGCACTGGTCTCCAGGGGTTCCTTGTCTTCAACGCTGTTGGAGGTGGAACTGGCTCTGGCCTTGGTTCTCTTCTCCTTGAGCGTCTCTCTGTTGAC
TATGGAAAGAAGTCCAAGCTTGGGTTCACAGTGTACCCATCCCCTCAGGTCTCCACCTCTGTTGTTGAGCCATACAACAGTGTCCTGTCCACCCACTCTC
TCCTTGAGCACACTGATGTGGCTGTCCTCCTTGACAATGAGGCCATCTATGACATCTGCCGCCGCTCCCTTGACATTGAGCGCCCAACATACACCAACCT
CAATAGGCTCGTTTCTCAGGTCATCTCATCCCTGACTGCTTCCCTG
page-top