Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig96
Contig Information
Length 641 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6f18    rwhok6f18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0211300 [Oryza sativa (japonica cultivar-group)] >gi|51090511|dbj|BAD35713.1| sterol carrier protein 2-like [Oryza sativa Japonica Group] >gi|51091903|dbj|BAD35172.1| sterol carrier protein 2-like [Oryza sativa Japonica Group] >gi|113595159|dbj|BAF19033.1| Os06g0211300 [Oryza sativa (japonica cultivar-group)] >gi|125554513|gb|EAZ00119.1| hypothetical protein OsI_22123 [Oryza sativa Indica Group] >gi|125596462|gb|EAZ36242.1| hypothetical protein OsJ_019725 [Oryza sativa (japonica cultivar-group)]
Score 421
Evalue 9.64771e-40
Total Hit Count 309
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig96
CCCTTCCCCTGTTCCCAAATCTTACTCCCCGTGCGCCGCGATGGAGGCGAGCAAGCTCAAGGCGGCCAGGCTCCTGGAGCAGATGAGCGCCCACCTCGCC
ACCGACGCCGGCAAGGAGATTGCCAACAAGGTCGGCTTCGTCTACCAGCTCAACATCTCGCCCAAGAAGATGGGCGTGGACGAGGAGATCTTCGTCGTGG
ACCTCAAGAAGGGCGCCGTCTCCACAGGGAAGTACGAGGGGACCCCGGACGCGGCCTTCACCTTCACCGACGACGACTTCCTCGCCATCGCCAGTGGCAA
GCTGAACCCGCAGATGGCGTTCATCCGGGGTAAGCTGAAGATCAAGGGGAGCATCAGCGCCGCGCAGAAGTTCACGCCGGACATCTTCCCCAAGCCGTCC
AAGTTGTAGAAGGCCGGATTGCCATCCCGTGCATCAAAAGAGTTTAGTTGTACAAGGCTGAAGATCAACGGTTAATAAAAGAGTCTAGTTGTGTTCGCGG
TGGCAATTTGGTGGGATTGTTACTGGGAAGGAGTTTGTTTACCTAGAACTACCACACGAACAGCAGAGGTTTCAGTCAGTGTCTCGAGTGAAATTCGTTT
TCTTTGGTTGAGAAGGAGAACACTANGTACGAAAAAAAAAA
page-top