Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig95
Contig Information
Length 959 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7l24    rwhok7l24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0530700 [Oryza sativa (japonica cultivar-group)] >gi|52077214|dbj|BAD46258.1| unknown protein [Oryza sativa Japonica Group] >gi|113631983|dbj|BAF25664.1| Os09g0530700 [Oryza sativa (japonica cultivar-group)]
Score 513
Evalue 1.49613e-61
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig95
ACGGGGAAGAGACGGATAGAGATGGGAGAGGCATCGCCGGAGTCCAGCGGCGCGGCGGCCGGAGGGCCGTCTATGCCGGGGCCGCCGAGGAAGGGGAAGT
CGTGCAAGGGCTGCCTCTACTACTCGTCGGTGCTCAAATCCCGGGGATACAACCCCATCTGCGTGGGGGATCCCTCGGTTCCATCCCCCAAGTCCCGGGC
TTCGTGGTGGAAGAGCCTAGGGAGGAGGCCGCGGCGCAGGGCCATGATCTGAGACAGTTCAAATACGCCTGCGCCGGTTACTCCATGTTCGTCGACGACA
GAGACGCCAAAAGCGGCGAGAATGACGCCAAGGCGCTGTTGCCGTATTGCCAGGGCCTCGAGCTACTGGTCGACAGCAGAATGGTAGAGAGGAAATCACA
AGCCGTAGAGCATGCTTCAGCACGTAATCCGAAGCCGAAGGAAGCTGCTGCTGCTGCCACCCAGCCTCAGGAGCAAGGACAGCGACCACAGCTGGCGAGA
CAGGAATTCATGGCGAGGTTCAGGAGGAGCGCCGGGCTGGTGGCCTCAGGGGTCGCCAAGAACCTCAACAAAACGGGCACCTACATCAAGCAAAACGTCN
AGGACATATTTTCCCCTGACCGACGGCCACCACCCAAGCAGTAGCCGGCTGCCACTCAAGGAGGTCGTCCATTTCCGAGCTGGGAAACTGGCATGCNCCG
GACGCTTTCCTGGGGCGTGGTACTGAATGAATTCCTTTTGCTGTATNCTTGTTTGATTTTTGCTATTTATATGGAAACAACTGGGGCCTGGTTATGTACA
TGAGAAACGGGATAGGGTGTTTCTGCTCCGTTGGGTGGTTGCTGAATAATAATATGTCCAAGGTGTTTGTTTCAACTCAGAAGGTCCTTCTGAGAAGGAG
GAATTCATGCTACTACTGTTCATCTATCAAGCACCCTACATACTCCCTCCGATCCATAT
page-top