Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig93
Contig Information
Length 797 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6f22    rwhok6f22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.3; AltName: Full=wcH2B-8 >gi|531058|dbj|BAA07157.1| protein H2B-8 [Triticum aestivum]
Score 503
Evalue 4.67151e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig93
CCACCTCACAAGTCTCCCGTCGAAGCAGCAGCGGCATCCATGGCCCCCAAGGCGGAGAAGAAGCCGGTGGCGGAGAAGGCCGAGAAGACCACGGCGGCAG
TGGCGGAGCTTCTCAGGGGCCAACCTGGGCCGTTGCCCCCCCAGCCCATGAATTTTTTCTGAAATACCCCTTAGTATTTGGCCCATATCTCAAGCAAAAT
CAGCCCAAAATACATATTGTTTGCCCCCCAGCCCATTGCCCCCCCTAGATTTCAGCCCAAGCTCCGCCACTGCACGGCGGCGAAGAAGACCAAGGCCGAG
AAGCGGCCGCCGGCGTCCAAGGAGGGCGGCGAGAAGAAGGGCAAGAAGAAGTCCAAGAAGAGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGA
AGCAGGTGCACCCGGACATCGGCATCTCCTCGAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGCGAGTCCGCCAA
GCTCGCGAGGTACAACAAGAAGCCCACCATCACGTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCT
GAGGGCACCAAGGCTGTCACCAAGTTCACCTCGGCTTAGATATTTTGTTCTCTGTCGTCCTGGTGGATCGATGTTGCTCTGTAGCTGTAGGTAGTGGTTC
GTACCATTTCATCTTGTAACTTGTGTGGGATCACCATACTGTTTCATGATCTGGAGGGAATAGTAACAGTGCTGATTTATTCTGTTTCAAAAAAAAA
page-top