Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig91
Contig Information
Length 399 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6f24    rwhok6f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit light-harvesting complex I; LHC I [Hordeum vulgare]
Score 215
Evalue 3.56019e-16
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig91
GGACCCCGCAAAGTTCGAGGAGCTCAAGCTCAAGGAGATCAAGAACGGCCCGCTGGAGAACCTGGCCACGCACCTCGCGGACCCGTGGCACAACAACATC
GGCGACATCGTCATCCCCAGAAATATCTACGGCCCTTGAGCGGAGCCGACCGGGCTGAGGGGAGATCGAGGAGCCGGAGCACATGGTTTTCATTCATGTT
TCTGCGTCGATCGACTGGTTGATCAACTTGCCACGCTGGCTCTGCGCGCGTACGTCCGTGCGTGCAGGAACTGTACAACAACGTCAGCTCTCCGGCCGGC
AACCTTTGTAATGTGTAAAGCTTAAGTAGTAGCCGCTGTTGTGAATGCACCCGTATGATCTGTATAAACTCTTGCATGATGATGGTCTTAAAAAAAAAA
page-top