Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig90
Contig Information
Length 911 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7f14    rwhok7f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195620520|gb|ACG32090.1| pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit [Zea mays]
Score 984
Evalue 4.87514e-118
Total Hit Count 179
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig90
ACTTGGGTTACAACTATGGAGTTGTCCTAATACCGGAAGGCCTGATTGATTTCATCCCAGAGATTCAAAAACTCATTGCAGAATTGAATGAAATTTTGGC
CACATGATGTTGTTGACGAGGCAGGGGGCTTGGAAAAGCAAGCTTGAACCAGCATCTAGGGAGTTGTTTGACTTCTTGCCCAAAACCATTCAGGAGCAGC
TTTTGCTTGAAAGAGATCCCCATGGCAATGTTCAGGTTGCGAAAATTGAAACTGAGAAAATGCTTATTGCCATGGTTGAAACTGAATTGGAGAAGAGAAG
AGCGGCGGGGAAGTACTCTGCACATTTCAGAGGCCAGTCTCACTTCTTCGGATATGAAGGAAGGTGCGGCCTCCCTACCAATTTTGATTCCAGCTATTGC
TATGCATTAGGCTATGGTGCTGGTGCTCTTCTCCAATTTGGCAAGACAGGACTTATTTCGTCGGTTGGTAACCTGGCTGCTCCTGTGGAAGAATGGACTG
TTGGAGGAACTGCACTGACTGCGTTGATGGATGTTGAGAGGAGGCATGGCAAGAACAAGCCAGTGATCAAGAAGGCTATGGTGGAACTTGATGCTGCGCC
ATTTAAGAAGTTTGCCTCGCTGCGAGATGAATGGGCCAGCAAGAACCGATACATCAGCCCTGGTCCCATCCAATTCAGCGGCCCTGGAAGCGATGCGTCG
AACCACACCTTGATGTTGGAGCTTGGCGCTGAGATATAGAGGCGGCGGTGTAGAGTGTATTTCTTTCAAATTTTCTACTTCTTCCTTGCAGTTTTGAGAG
TGGAGAACAAACTCCCATAGCGGAAGCGGCAGTCTCCGCATTGTGGAATGTTTAATAAGAGGTTGAGTTGGAGTGGGTTCAGTGGATGTCGTAATAACTA
ATTTTAGCTTT
page-top