Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig89
Contig Information
Length 676 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6g07    rwhok6g07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Solanum tuberosum] >gi|77745497|gb|ABB02647.1| unknown [Solanum tuberosum]
Score 667
Evalue 3.20568e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig89
CGCCTTCCTGCTTGCCGCTCTCGCTCCGCAGACGCCGCCGCCGCCGCCGCCGCCACGGCCAGAGCTCGACTCGCTCCCTAGAGGTAAGGATGGTGAGAGT
CAGTGTGCTGAACGATGCTCTCAAGAGCATGTACAACGCTGAGAAGCGTGGGAAGAGGCAGGTCATGATCAGGCCTTCTTCCAAGGTCATTATCAAGTTC
CTTATCGTCATGCAGAAGCACGGATACATTGGCGAGTTTGAGTATGTTGATGATCACAGGTCTGGCAAGATCGTGGTCGAATTGAATGGCAGGCTGAACA
AGTGTGGTGTCATCAGTCCTCGCTTTGATGTTGGTGTCAAGGAGATTGAGGGATGGACTGCAAGGCTCCTGCCTTCTCGTCAGTTTGGCTACATTGTGCT
GACAACTTCTGCTGGGATCATGGACCATGAGGAGGCAAGGCGTAAGAATGTTGGTGGCAAAGTGCTAGGCTTTTTCTACTGAAAATGGAAAATGGAAAAT
TGGATGAAAGTACCTGAGATGTGTTAGTAGGATATTTCCAAGGAACACCTAAGTTGTCTTTTTTTTGTCTGACTAGCTGCCGCTGCTTGTTGAGTTATTC
TGGAATCTGTTATGCACTTTGGGATTGGGTGCCTTTGTTTGAAAACTATGAGCTGTGCCTGTCGTTAAAAAAAAAA
page-top