Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig88
Contig Information
Length 564 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7l05    rwhok7l05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08486 [Oryza sativa Indica Group]
Score 191
Evalue 3.2534e-13
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig88
CACCATCGAATTCTTGCAAGGCAAGCAAGGCGAATTCGGCATGGACTCCTTCTCGTCGCCGTCGATGTCGTCGTCAGGGTCGTCCCCCAACCCGGAGGCG
CTCATGGAGCAGATCAAGGCGCAGCTCGCGCAGGCCTATGCCCAGGAGCTTCTTGAGACCGTTGGGAACAAGTGCTTTGCAAAGTGTGTGACCAAGCCAG
GATCAAGCCTGAGCGGAAGCGAGAGCAGCTGCGTGTCACGCTGTGTTGATCGTTACATTGAGGCAACTGGCATCGTCGGCCGGGCTTTGTTCAGTCACCG
TTAAGAAGCTGGGTAGTGATGAGATGAGGTGAACTGGTAATATGAGGCGAGCTTTTGTCTAGAGTCTTGTGTGGTCAGAATACAGTAACAGTTGCTACTC
AGGTCGTCATGCAGTGTTTGGTTGGGTCGGGACGCTCCATATTTTCATTGCGCCATTGTAGGTTTGCGAAAGAAACAGGATGTATTTGAGTGGTGAAGGT
CTTTTGGTTAAACTTGTTCTAATATTATTTTTTTCTGAGCAACAAACTCGTAATAAAAAAAAAA
page-top