Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig87
Contig Information
Length 1279 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7l03    rwhok7l03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0243000 [Oryza sativa (japonica cultivar-group)] >gi|56784585|dbj|BAD81632.1| unknown protein [Oryza sativa Japonica Group] >gi|113532091|dbj|BAF04474.1| Os01g0243000 [Oryza sativa (japonica cultivar-group)] >gi|125569702|gb|EAZ11217.1| hypothetical protein OsJ_001042 [Oryza sativa (japonica cultivar-group)] >gi|215693274|dbj|BAG88656.1| unnamed protein product [Oryza sativa Japonica Group]
Score 972
Evalue 2.88624e-152
Total Hit Count 90
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig87
CCTTCCTTCCTCGGCGCCCTTTCCTTCACCGCTAATGCACCGCCACTCCTCCGCCCAAGAGGCGCAGGCGATGGGCAGCAACGGAGGCGGCGCCAAGCCG
CCGGCGTGGGAGTTCCACACCACGGGGCCTCGCAACCTCTCCAGCCCCGGCCGCTCTGCCTGGAAAAATCCCAACTACAGAAGAATTGCAATTTCATGTT
TAGTGCAGGCAGCGTACGTATTGGAGTTTGACAGGCAAGAGAACAGAACTGGTGAAACTGCCATTGCTCCTAACTGGTGGAAGCCATTTAAATACAAGCT
GGTGCGCCTTCTAATTGATTCCAGAGACGGATCCATATATGGGGCACTTCTAGAATGGGACCAGGTTGCTGCACTATCAGACTGGATAATGCGGAGACCT
GTTGGTGCTCCAAAGGCTGTCCCTGGCACTGAGGGGAACTGTCCTGAAGCAGTCAACTGTTGCGAGAGACTTGGAGGATGACCTCAGGTACTTTGCTCAG
GAGAGCTTGAGGGGTTCTGTCAGGTTCGCTGGAGCACTGGAGGTGCTCAAGTCGGCAATCGATAAGCATGGAAGCAACAATGTGTGCGTTGCTGGGCATT
CCCTAGGGGCCGGATATGCGATGCAGGTTGGTAAGACTTTGGCGAAGGACGGAGTCTTCGTAGAATGCCACTTGTTTAACCCACCATCAGTGTCACTCGG
CCTGGGCCTGAGGAAGCTTCAGGATAAAGTCGACAAGGTGTTGAAGCGATACATCAGCGGCAGCTCTTCGAACGCCGGTGAAATTTCTCACCCGGGAGAG
AAGGGGGAAACTGTCTCTGAAATTGGAGAAGAGAATCTGATCAAGGAGGTGAAGAGATGGGTGCCCAACCTGTACATCAACAACAGCGACTACATTTGCT
GCTTCTACGTTGACCGTAGTGGCGTACCCACTGTTACTGCAGAGAAGCGTGGCGATGGTCACCCTGAGGCACGTGCCAAGGTTTTTGTGATTGCTAAAGG
TCCTCAGAAATTTCTAAAAGCTCATGGGCTGCAGCAATGGTGGATGGATGATTCCGAGCTCCATCTGGCTGTGAATGAGAGCAAGCTCATGTATAAGCAC
CTCAAGTCCCTGTATGTGAAAGAAACGTAGCGAAACCAATATCATTGTGATCTCTGTCTCCTGTTGTCTCCTGTTCTGTAGCCAAGTAAACTTTTAAAGC
TCTCATGAAGCTATCCAGTTCCTGCAAACCTTTTAGTCAGTTAAGCTCGTATCCAAATTAATCTGTCAGTATGAAATGT
page-top