Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig85
Contig Information
Length 473 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7k11    rwhok7k11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll a/b-binding protein [Mesembryanthemum crystallinum]
Score 412
Evalue 5.04964e-39
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig85
CTCTACCCCGGCGGCAGCTTCGACCCCCTGGGCCTCGCCGAGGACCCCGAGGCGTTCGCGGAGCTCAAGGTGAAGGAGATCAAGAACGGCCGCCTCGCCA
TGTTCTCCATGTTCGGCTTCTTCGTGCAGGCCATCGTCACCGGCAAGGGGCCCCTGGAGAACCTCGCCGACCACCTCGCCGACCCCGTCAACAACAACGC
CTGGGCCTTCGCCACCAACTTCGTCCCCGGCAAGTGAGCGCGGTCAGCTCAACCTCTAGGCCGACAACTTCATGGCTGATGGATGCTGCTGCATGTGTGT
CGTCGTCGATCTCTGCTTCTTCCCGTTGTGAGATTGAGTAGTCCGGACTGATAGATGTTGCATGTGAGGGCGAGTCGAGATGAGGAGTTGGTGTGTGTAC
ACTAAGATGGTGTTTGTGTAATATCTGGCTATTTTCTCAGATTAATCAAGGCATCTCTGTTCTAAAAAAAAAA
page-top