Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig84
Contig Information
Length 978 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7f06    rwhok7f06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, unclassified [Oryza sativa (japonica cultivar-group)]
Score 255
Evalue 3.76201e-20
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig84
AGCAGCGCTCAAGATCTGTAACAGAGTATGCAGGTGAAGTAAAGAAATTATACAGAGACTTACATTATCATCACCCTTTTGAACCTGTTCACAAGGGATG
ACTTGGCAATTCATCATGTGTGGTTTGAGTTCGTTTGTGAGCAAGCTCTTTCTTGATGGCCTAGACCAGGAACTAAACCTCCCGTCGTCAATTGATATTT
GCAATGCCCTGAGTGGCCTAGTCTTGATGATATTATTTCTAGCATGATTGAGGAGGAGACTCGTTTGGCACAACCGAAGGAGGATGGTCAAGAGCGTGCA
GATGCTCGTGCTGCATTATCCGTACAACCTCGTCGTGCTACAAATTCCTTTGGTAAGGTGGATAAAAGCAAATTGCTTTGTGACCATTGCAAGAGAAAAG
GACACACCAAGGGTGAGTGTTTTGAGTTGCATGGTTATCCACCTTGGTGGGATAAAGGGAGATCTCGGCTAGGGGGAGCTCGGGGTTCAAACAAAAGACA
AGCTAATTACAATGCATCTGCAAGGGAACTACCTGTGGTAGATATGCAAGCTCTTGAGGATTTCAAATCCAAGCTCAAACTCTCTGAAGGCTCATCTTCG
TCCCAAGGTTCCTCCAAACTTGATTCTAGCTTTAATGCCATCACCCAAGGAGCTTGGGACAGGGAGAGTTCTCGGGACTGGGACCATGCATGAGGGACTC
TACTATCTTGATGAAGGGGGAGATGAAATTGCTCTTGCAACCTGCATGTCTCCTACTCAAGAATTGTTACTTCACCACCGAAGATTGGGACACCTCTCTT
TTGCTGCTATGTCACGTATTTATCCCTCTCTCTTTAAATTGTGTTCTAGAGAATCCCTTGTATGCGATGCATGTGAATTAGCAAAACATACAAGGGGTAC
CTATCCTAGCAAGGGTTTGCGAAGTCATAAACCATTTGAAGTAATACATTCTAATGTTTGGGGGCCCTGTGAGGTTAT
page-top