Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig83
Contig Information
Length 602 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7k08    rwhok7k08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H1 [Zea mays]
Score 193
Evalue 2.27825e-13
Total Hit Count 176
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig83
GCTCGGTCGCCATCGCCAAGTACATCGAGGAGAAGCACGGCAAGGCTCTCCCGGCCAACTTCAAGAAGATGCTCTCCGTCCAGCTCCGCTCCTCCGCCGC
CAAGGGCAAGCTCGTCAAGGTCAAGGCCTCCTACAAGCTCTCCGACGCCGCCAAGAAGGACTCCCCCAAGGCTAAGCCCGCGGCCAAGCCCGCCAAAGAC
GCCGCCAAGGCCAAGAAGACGGTGGCCGCGAAGCCCAAGAAGACCGCCGCCGCTGGCACCAAGCGCAAGGCGCCCGAGAAGAAGAAGCTGGTCACCAAGG
CCAAGAAGTCGCCGGCGGCCAAGGCCAAGGCGAAGCCGAAGACCGTCCGCTCCCCGGCCGCCAAGAAGGCACGCAAGGTCGCCGCCGCCTGATCTGATCC
TATCCGATATCTGGTCTTAGGAGTGCTTGGTGTTCAAGGGGCTGTACAAAAGGATGCCTCATCCTCCCTTGTTTAGGTTTCGGTTCTGCTAGGCAAGTTT
ATGTATCGTGGGTGGTGTTTAGTGTAATGTAATGGTTGCTTTAGAGATGTTTTCAGCTCTAACTCTGTGAAATGAATCTGCAGTTTCTCCATAAAAAAAA
AA
page-top