Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig82
Contig Information
Length 487 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6g17    rwhok6g17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_30553 [Oryza sativa Indica Group]
Score 331
Evalue 1.25674e-29
Total Hit Count 146
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig82
CTGAATTATATAGAAGACAGCGCTGGAGGCGCGGATGTCACAGTTGGCATTCTTGCAAAGATGGACAAAGTGACTCTTCTGCAGATGGACGCGAAACTAC
CAATGGATACATTTGAGACTGTGATGGACCTTGCAACTGAAGGGTGCAAAGCGATCGCAACCTACATCCGAGAGGTGCTATTGGAGAACACGAAGCAGCT
GGAGTGTCAGCGAGGCTAGTTAAACGAGAGCCTGTGGCACTTGAAGGCGGGTCTGTTGTGTAACGCTGATTGATGGCTTATCTGCCTAGCAGAGCTAGCA
TTGAGAGAAAAAATGACACTGAACCTGTCAAAGATAGCTGGACCATCATTTTCCCTCCTAATGTATGCTGTAGCGTGCAGGAGATGACATCTTGATTATG
TGGAACTTTGATGTTGAACTTGGTATCCATGTTGTACTTTTGAAAATGTTTTAACATGCTGCAAATTTAACTTAAATAAAAAAAAAA
page-top